![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
phi x control on the same lane with sample? | jasmineja | Illumina/Solexa | 17 | 11-30-2011 01:10 PM |
ChIP-Seq: ChIP-Array: combinatory analysis of ChIP-seq/chip and microarray gene expre | Newsbot! | Literature Watch | 0 | 05-19-2011 03:50 AM |
3.4GHz Quad-Core Intel Core i7 versus 3.1GHz Quad-Core Intel Core i5 | brachysclereid | Bioinformatics | 2 | 05-03-2011 06:31 PM |
BFAST: Need "Phi X 174" file example dataset | CS Student | Bioinformatics | 10 | 04-04-2011 12:32 AM |
![]() |
|
Thread Tools |
![]() |
#1 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,080
|
![]()
Intel announced Xeon Phi co-processors with a claimed teraflop of performance in a PCIe form factor.
http://blogs.intel.com/technology/20...nd-innovation/ Any code that runs on standard xeon is supposed to run on this. |
![]() |
![]() |
![]() |
#2 |
Rick Westerman
Location: Purdue University, Indiana, USA Join Date: Jun 2008
Posts: 1,104
|
![]()
Purdue is building a cluster with Xeons plus the Xeon Phi. Impressive statistics but all for non-bioinformatics programs (if you discount modeling as being bioinformatics). The Phi (for those who do not know) is basically a 1GHz, 60-core, 4-thread-per-core, 8 GB extremely fast memory x386 chip that is optimized for floating point. So if I had a program that could work with 240 threads then the Phi would be great. But I am wracking my brain for a bioinformatics program that could actually use 240 threads without creating I/O bottlenecks. Any ideas?
Oh yes, going back to GenoMax's post, the presenters at the seminar I went to today did say that the same code will run on the 8-core Xeon chip and the 60-core Phi processor. |
![]() |
![]() |
![]() |
#4 |
Rick Westerman
Location: Purdue University, Indiana, USA Join Date: Jun 2008
Posts: 1,104
|
![]()
Going into specifics. Each node has two 8-core Xeon with 64 GB memory plus two 60-core Xeon Phi coprocessors. The nodes are connected to a 1.6 PB "Lustre" scratch file space via a QDR Infiniband, 18GB/sec throughput. If I got my information down correctly that 18 GB is not shared with other nodes. And yes, the brochure has the big 'B' implying Bytes instead of bits -- Wikipedia says QDR at 12x is 96 Gbit/sec actual, uni-directional.
So, it would take, oh not that long to load in a hiseq lane's worth of data but then what would the Phi chip do with it? Need software!! |
![]() |
![]() |
![]() |
#5 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,080
|
![]()
The storage would likely be mounted through an Infiniband switch so an individual node would not see anywhere close to the 18GB/s speed since that bandwidth would be shared.
Did you get any details about how the Xeon Phi processors show up on the node? Are they going to appear to the OS as "16 + 120" cores? If that is not the case then is there some other piece of software that allows the on board Xeon's to talk with the co-processors? As with the graphics cards we are going to be limited by the bandwidth of the PCI-E bus. Last edited by GenoMax; 08-28-2013 at 02:37 PM. |
![]() |
![]() |
![]() |
#6 |
Senior Member
Location: San Francisco, CA Join Date: Feb 2011
Posts: 286
|
![]()
PCIe v3 x16 is 15.75 GB/s. For reference Sandy Bridge QPI is 64 GB/s. So it is still pretty damn good. However, I still don't think there is much bioinformatically that will make great use of 60 slow cores (and very low RAM) vs 16 fast cores (and potentially lots of RAM). Even things like blat require about 2GB per process. Bowtie or BWA would probably hit the GB/s bandwidth limitation before soaking 60 cores, but I might be wrong about that.
|
![]() |
![]() |
![]() |
#7 |
Senior Member
Location: Connecticut Join Date: Jul 2011
Posts: 162
|
![]()
This mostly seems like Intel's answer to the Tesla series from NVIDIA that have been out for a while now, only you won't need to tweak your code as much. I know our engineering department has discussed installing a few of these in our cluster, but they already have a bunch of nodes that include Tesla chips and as far as I know the only people who use them are doing computational modeling.
The Phi seems to be another leap in hardware like the Tesla was, but the software just isn't there yet to fully take advantage. My suspicions are that by the time a compelling piece of software comes out to use that much processing firepower, the sequencing realm will have advanced to the point that it might not matter. |
![]() |
![]() |
![]() |
#8 |
Senior Member
Location: sub-surface moon base Join Date: Apr 2013
Posts: 372
|
![]()
Wouldn't this be great for things like Blast?
|
![]() |
![]() |
![]() |
#9 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,080
|
![]()
I keep forgetting that Phi is ultimately a co-processor and as such is going to be limited to an extent.
|
![]() |
![]() |
![]() |
#10 |
Senior Member
Location: Connecticut Join Date: Jul 2011
Posts: 162
|
![]()
Yes, but Blast and a lot of similar applications (HMM, BLAT, etc.) that would be suited for this chip have already been ported for the Tesla chips, and they still don't get significant usage.
These chips will ultimately find a use in bioinformatics, but I don't expect anything amazing. The problem with bioinformatics isn't really a lack of processing power, but well designed software and algorithms that can easily and readily take advantage of that power to do something better and more useful than previous options. |
![]() |
![]() |
![]() |
#11 | |
Rick Westerman
Location: Purdue University, Indiana, USA Join Date: Jun 2008
Posts: 1,104
|
![]()
Back from an extended vacation weekend. In response to GenoMax's comment about infiband (IB) speeds this is what I am getting from the technical people. They talk about our old cluster and our new cluster. The major difference between the two is (1) the Phi co-processors and (2) all nodes now have 64 GB memory instead of a mixture of 32 GB and 64 GB.
Quote:
We still need a good bioinformatics use case for the Phi co-processors. I am not sure if Blast is it, though, since it seems like it would be I/O-limited or memory-limited. Really, what we need to consider is what bioinformatics program is compute-bound? Or a program where we can trade off IO & memory for compute requirements. As mcnelson.phd bioinformatics is generally not limited by cpu power. |
|
![]() |
![]() |
![]() |
#12 | |
Rick Westerman
Location: Purdue University, Indiana, USA Join Date: Jun 2008
Posts: 1,104
|
![]()
And just to reinforce what the Phi needs in terms of programming, here is a quote from a Dr. Dobb's article.
Quote:
|
|
![]() |
![]() |
![]() |
#13 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,080
|
![]()
You should still see a nice boost to your normal workload once the new cluster becomes operational.
On a different note if you have not used HiSeq Analysis Software (HAS) before then this could be a good test for your cluster. HAS is designed to basically take over all hardware resources on a node (note: a minimum of 48 GB RAM is needed) and run WGS/Enrichment workflows at maximum speed possible on the hardware in question (HAS will generate tens (perhaps hundreds in your case) of alignment threads automatically). If your admins are willing to install HAS (currently supplied as an RPM on iCom) and you have access to a flowcell with human samples (ISAAC aligner only has hg19 indexes, I have not tried to build others yet) give it a whirl. We have got it working on LSF though illumina does not officially support it. PS: I am not sure if the Phi processors can access the RAM on the node (i.e. not the local RAM). If they can't then this may not be worth pursuing. Last edited by GenoMax; 09-04-2013 at 07:44 AM. |
![]() |
![]() |
![]() |
#14 | |||
Rick Westerman
Location: Purdue University, Indiana, USA Join Date: Jun 2008
Posts: 1,104
|
![]() Quote:
If I could make the argument that the new cluster would increase compute speeds by a significant amount via using the Phi then the purchasing decision would be much easier. As it is we will probably wait until 2014 when we hope that Central IT (the people running the clusters) decide that a slower yet large memory cluster would be a Good Thing To Have. Of course who gets into the "let's have some bragging rights" supercomputing top 100 list that way. :-( Another way to get into the new cluster would be to create a internal grant proposal to port some bioinformatics software to the Phi coprocessors. But I am just not getting a good idea of what, if any, software could be profitably ported. Quote:
Quote:
|
|||
![]() |
![]() |
![]() |
#15 | |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,080
|
![]() Quote:
|
|
![]() |
![]() |
![]() |
#16 | |
Senior Member
Location: Sydney, Australia Join Date: Jun 2011
Posts: 166
|
![]() Quote:
e.g. >gi|406684590|gb|CM001582.1| Ovis aries breed Texel chromosome 1, whole genome shotgun sequence ATGGGGACATGACCGGGAGGTGGGCAAGGAGAGCGTCTACAGCTCAGGGGAGCCAGGGATCACCGCTCCC ... I don't see the point of variant calling for a draft genome, though. |
|
![]() |
![]() |
![]() |
#17 |
Senior Member
Location: Germany Join Date: Oct 2008
Posts: 415
|
![]()
So is anyone using Phi in bioinformatics these days ? We do have a great number of compute bound processes (blastx, blastx) in a productive pipeline which could be sped up.
I do wonder about the utility for typical IO and memory bound bioinformatics applications such as NGS though. |
![]() |
![]() |
![]() |
#18 | |
Rick Westerman
Location: Purdue University, Indiana, USA Join Date: Jun 2008
Posts: 1,104
|
![]() Quote:
|
|
![]() |
![]() |
![]() |
Tags |
hpc, intel phi co-processors, parallel apps |
Thread Tools | |
|
|