SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
split fastq file Balat Bioinformatics 10 09-22-2016 08:55 AM
Sort and Split shuffled (interleaved) fastq file nposnien Bioinformatics 4 08-08-2012 08:41 AM
split a fastq file lfaino Bioinformatics 4 04-14-2011 04:28 PM
Split fastq to fasta and qual file? ewilbanks Bioinformatics 8 01-07-2011 03:02 AM
Split GA FASTQ file aritakum Bioinformatics 3 06-10-2010 05:15 AM

Reply
 
Thread Tools
Old 08-31-2012, 07:09 AM   #1
empyrean
Member
 
Location: EU

Join Date: Sep 2010
Posts: 52
Default Split fastq file with renaming reads

Hi

I am trying to split fastq file to one read per file seperately and rename the read name. For example

Code:
@HBGAIY001A
TGTCTCAACTAATTTAGCCGCAGACCAAGTCTCTGCTACCGT
+HBGAIY001A
III???HIHG<<???EEEEE?BBF9999?EEEF>@@AEAA?999:=II
@HBGAIY001A
GGAACATGAACAGACCAAGTCTCTGCTACCG
+HBGAIY001A
4400/67766724/0088??AAAA???FFFFFFFC
The above is example for two reads and i have big file with reads. Now i wanted to make them in to seperate file i.e here two files and rename the read name. After that it should be like this

File 1:

Code:
@Sample1_HBGAIY001A
TGTCTCAACTAATTTAGCCGCAGACCAAGTCTCTGCTACCGT
+Sample1_HBGAIY001A
III???HIHG<<???EEEEE?BBF9999?EEEF>@@AEAA?999:=II
File 2:
Code:
@Sample1_HBGAIY001A
GGAACATGAACAGACCAAGTCTCTGCTACCG
+Sample1_HBGAIY001A
4400/67766724/0088??AAAA???FFFFFFFC
empyrean is offline   Reply With Quote
Old 08-31-2012, 08:38 AM   #2
Richard Finney
Senior Member
 
Location: bethesda

Join Date: Feb 2009
Posts: 699
Default

You need to learn a scripting language: bash, perl ,python or a higher level language C,C++,java. Meeting your specification is trivial using these tools.
I'd recommend figuring out bash and the standard UNIX utilities (sed/grep/awk/tr) because if you succeed, your going to need them for de-complicating your life.

But ...
You don't want to do what you are suggesting. Fastq files are very large. I mean ... MUCHO GRANDE ... HUGEMONGOS number of records. Imagine creating a file for every record. Result: too many files. It's damn near impossible to manage tens of thousands of files. Even listing the files just to see what's in a directory becomes very difficult. Are you going to scroll for 9 minutes trying to find a record?

There's probably better paths to reaching your goal.
Richard Finney is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:36 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO