LinDA Library Prep Issue

[jeremyy7]

Hello All,

I am using a method known as LinDA (linear DNA amplification) and it involves using an oligo that is cut off at the end using BpmI. This restriction enzyme cuts 14 bp downstream of its recognition sequence. You are supposed to use amplification free library prep using modified solexa adapters that bind directly to the flow cell. The two adapters are:

A: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCC
GATC*T, * indicates phosphorothioate

B: GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCT
TCTGCTTG

In the protocol it states that "LinDA generates DNA fragments with 3′ recessive 2-bp overhangs. Modification of the Solexa adapter to contain the 16 possible dinucleotides will spare the end repair and 3′-A addition steps in the Illumina protocol".

What does this mean to you? Would I need to make 16 different adapters?

See Shankaranarayanan et al.'s "Single-tube linear DNA amplification (LinDA) for robust ChIP-seq protocol" for more info.

[JeremyDay]

instead of a T overhang, adapters with degenerate di-nuleotide overhangs? In which case you can just add NN onto your primers when you order them

[JeremyDay]

Oh, and dont forget to keep the T there. Dont replace it with NN. If using standard illumina seq primers, it needs to be there.