SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
help needed to retrieve fasta reads from fasta db prashanthpnu Bioinformatics 1 06-21-2011 05:59 AM
Tablet assembly viewer valei Bioinformatics 2 03-07-2011 07:09 AM
Looking for a NGS viewer in iPad kenosaki General 6 02-01-2011 11:30 PM
a viewer for RNAseq data ragowthaman Bioinformatics 7 01-22-2011 06:33 AM
SOAPsnp pileup viewer sukhbat Genomic Resequencing 2 09-23-2010 01:05 PM

Reply
 
Thread Tools
Old 02-23-2012, 10:01 AM   #1
ashkot
Member
 
Location: Cupertino, CA

Join Date: Nov 2011
Posts: 59
Default FASTA Viewer

Hi all,
I have several large FASTA files and i wanted to know if there is a FASTA visualizer for Windows or Linux?

Thanks in advance.

Regards,
Ashwin
ashkot is offline   Reply With Quote
Old 02-23-2012, 01:32 PM   #2
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,177
Default

Ashwin,

FASTA files are simply plain text files; they could be opened with any text editor. What do you wish to do with these files? There isn't really much to "look" at in a FASTA file, it's just a long string of DNA sequence (or RNA or protein).
kmcarr is offline   Reply With Quote
Old 02-23-2012, 01:51 PM   #3
ashkot
Member
 
Location: Cupertino, CA

Join Date: Nov 2011
Posts: 59
Default

Hi,
I wanted to search for a sequence in a FASTA file, for e.g the sequence could be

GGTTCCGCTTTCCACTGCTGCCGCCAGTCGGCCTGAGATGCACTGGCCTCGGCCTCAGAGGAGGCAGTCGCTGACACCTGGCTCCAGGTCCTGGAATCCGGAGGGGCCTCTGGGCCACCGG

OR

GGTTCCGCTTTCCACTGCTGCCGCCAGTCGGCCTGAGATGCACTGGCCTCGGCCTCAGAGTAGGCAGTCGCTGACACCTGGCTCCAGGTCCTGGAATCCGGAGGGGCCTCTGGGCCACCGG

If the FASTA was viewable, then i could do a find for confirmation, i.e. to confirm that the searching code is working fine.

Does the program FASTA search for a sequence within a FASTA file.

Ashwin
ashkot is offline   Reply With Quote
Old 02-23-2012, 10:56 PM   #4
arvid
Senior Member
 
Location: Berlin

Join Date: Jul 2011
Posts: 156
Default

If you do a simple text search with a text editor, you might miss it since the file contains linebreaks.

I'd simply make a BLAST database out of the FASTA file and use BLAST to find the matching position.
arvid is offline   Reply With Quote
Old 02-24-2012, 01:00 AM   #5
ashkot
Member
 
Location: Cupertino, CA

Join Date: Nov 2011
Posts: 59
Default

Hi there,
I did run formatdb on my FASTA file but i am getting an error stating index file not found.

Do you know the exact syntax for formatdb to convert a .fasta file into a BLAST able .fasta database file.

Thanks in advance.
Ashwin
ashkot is offline   Reply With Quote
Old 02-24-2012, 02:32 AM   #6
arvid
Senior Member
 
Location: Berlin

Join Date: Jul 2011
Posts: 156
Default

Legacy BLAST formatdb for nucleotide FASTA files:
Code:
formatdb -p F -i file.fasta
To search:
Code:
blastall -p blastn -d file.fasta -i query.fasta
Execute "formatdb --help" and "blastall --help" to see all options.
arvid is offline   Reply With Quote
Old 02-24-2012, 03:49 AM   #7
colindaven
Senior Member
 
Location: Germany

Join Date: Oct 2008
Posts: 415
Default

Another, perhaps more user friendly approach for non bioinformaticians might be
Artemis from the Sanger Institute.

A good text editor, i.e. Notepad++ on Windows, might do the trick too, but watch out for
line breaks.
colindaven is offline   Reply With Quote
Old 02-26-2012, 08:23 PM   #8
Kennels
Senior Member
 
Location: Sydney

Join Date: Feb 2011
Posts: 149
Default

If you are familiar with command line terminal, you could try grep in the command line:

Code:
grep "yoursequence" yourfastafile
Using the '-B 1' option will allow you to grab the header for this sequence too:

Code:
grep -B 1 "yoursequence" yourfastafile
if you have a text file with each sequence on each line you can use fgrep:

Code:
fgrep -B 1 -f filewithlistofsequences yourfastafile
These will produce an output to the screen if the sequence exists (or you could redirect to another file using '> output.txt'). Otherwise there will be no output. But the search will only be for exact matches, and will miss sequences with line breaks in between.

Last edited by Kennels; 02-26-2012 at 08:32 PM.
Kennels is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:32 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO