SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
BWA using reads in FASTA format aggp11 RNA Sequencing 7 08-11-2012 05:55 PM
Reads that can align to multiple places ashwatha Bioinformatics 2 09-21-2011 07:21 PM
How to convert diploid abi file into two fasta sequences? ymc Bioinformatics 1 04-28-2011 06:24 PM
Mapping against multiple sequences michaelDP Metagenomics 2 10-15-2010 09:22 AM
PubMed: PASS: a Program to Align Short Sequences. Newsbot! Bioinformatics 0 02-17-2009 05:00 AM

Reply
 
Thread Tools
Old 06-30-2011, 05:12 AM   #1
pchiang
Junior Member
 
Location: Taiwan

Join Date: Jun 2011
Posts: 3
Default Align multiple sequences in tabular or fasta format

Hi Folks,

I have ~100,000 short sequences (~25bp long) in fasta format. They are oligo probes used in affymetrix mouse 430-2 chip. I want to align all the sequences with mm9 genomic database to get either GFF or BED output. Can anyone suggest a good web- or windows-based tool for this purpose?

The following is an example of the first probe, thanks!

>probe:Mouse430_2:1415670_at:269:753; Interrogation_Position=2436; Antisense;
GGCTGATCACATCCAAAAAGTCATG
pchiang is offline   Reply With Quote
Old 06-30-2011, 05:15 AM   #2
NicoBxl
not just another member
 
Location: Belgium

Join Date: Aug 2010
Posts: 264
Default

There a several short read aligner for this purpose :

- Bowtie
- Soap2
- BWA
- Novoalign
- ...
NicoBxl is offline   Reply With Quote
Old 06-30-2011, 06:56 AM   #3
husamia
Member
 
Location: cinci

Join Date: Apr 2010
Posts: 66
Default

For online based, I have seen Galaxy which i think would be good option since your dataset it small.
husamia is offline   Reply With Quote
Old 06-30-2011, 12:56 PM   #4
pchiang
Junior Member
 
Location: Taiwan

Join Date: Jun 2011
Posts: 3
Default

Thanks to NicoBxl and husamia.

Still trying to understand how to install bowtie in windows....

I did tried galaxy using my fasta files. It turned out in error "reads file does not look like a FASTQ file." Galaxy requires 2 more columns (strandness and quality score) to run the alignment. However, it is not working even I tried to add 2 dummy columns and change the file identity from FASTA to FASTQ.

Does anybody know how to run alignment without going through FASTQ requirement on galaxy? Thanks a million!
pchiang is offline   Reply With Quote
Old 06-30-2011, 03:25 PM   #5
kwatts59
Member
 
Location: nevada

Join Date: Apr 2011
Posts: 46
Default

Write a simple PERL script to convert your FASTA format into a FASTQ format.
Then run bowtie to do the alignment.
kwatts59 is offline   Reply With Quote
Old 06-30-2011, 04:23 PM   #6
Kennels
Senior Member
 
Location: Sydney

Join Date: Feb 2011
Posts: 149
Default

Galaxy should auto detect your format, and it should be able to take up fasta formats. If it is spitting out a fastq related error, make sure you are uploading with the correct options.
Otherwise, the headers to your fasta file may be causing problems? Not sure if you can use wordpad or some other program in windows to change the headers to something simpler if you aren't familiar with command line.
There are windows large text file editor programs such as 'gVim', or google for one.
Kennels is offline   Reply With Quote
Old 07-01-2011, 06:00 AM   #7
husamia
Member
 
Location: cinci

Join Date: Apr 2010
Posts: 66
Default

Quote:
Originally Posted by Kennels View Post
There are windows large text file editor programs such as 'gVim', or google for one.
anybody has experience with opening large text files such as fasta in windows? I usually like to use search and replace function alot what are some good editors for large files ~12GB
I know this is huge file but I wonder if there anybody know of editor that responsibly handles such files without hogging up memory or crashing.
husamia is offline   Reply With Quote
Old 07-01-2011, 10:18 PM   #8
pchiang
Junior Member
 
Location: Taiwan

Join Date: Jun 2011
Posts: 3
Default

Turned out working by aligning using bowtie! Thank you everyone for your suggestions.
pchiang is offline   Reply With Quote
Reply

Tags
alignment, bed, fasta, gef

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:13 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO