SEQanswers

Go Back   SEQanswers > Applications Forums > De novo discovery



Similar Threads
Thread Thread Starter Forum Replies Last Post
interpretation of binding motif from a list mathew Bioinformatics 0 02-07-2012 10:09 AM
[Velvet,assembly] core dumped occured by runnning velvet matador3000 De novo discovery 0 12-17-2011 07:31 AM
interpretation of FASTQC Overrepresented Kmers mattanswers Bioinformatics 1 09-20-2011 12:40 PM
Help interpretation indel labmtl Illumina/Solexa 0 03-29-2011 07:01 AM
MAQ: SNPs interpretation, etc! nanelle Bioinformatics 0 08-25-2009 10:51 AM

Reply
 
Thread Tools
Old 02-23-2012, 10:27 PM   #1
nxtgenkid10
Member
 
Location: india

Join Date: Feb 2011
Posts: 16
Default Velvet Interpretation

Hi I m trying to run velevt with the a bacterial genome with the following condition

k-mer=31 -cov_cutoff auto -exp_cov auto -ins_length 1000 -exp_cov 5 n50 of 1399.

k-mer=15 -cov_cutoff auto -exp_cov auto -ins_length 1000 -exp_cov 5 shows results to be n50 of 11.

My Concerns

1 :how k-mer effects the contig formation
2 : Which Files i have to see for the # of contigs formed by a particular set of parameters
nxtgenkid10 is offline   Reply With Quote
Old 02-24-2012, 01:16 AM   #2
nangillala
Junior Member
 
Location: Germany

Join Date: Aug 2011
Posts: 9
Default

Hi,
Quote:
Originally Posted by nxtgenkid10 View Post
1 :how k-mer effects the contig formation
Let me cite the Velvet Manual here:
Quote:
As is often the case, itís a trade-off between specificity and sensitivity. Longer kmers bring you more specificity (i.e. less spurious overlaps) but lowers coverage. . . so thereís a sweet spot to be found with time and experience.
You can read a bit more on page 16 of the Velvet Manual. There's a lot of discussion about the choice of k-mers in publications and on this forum.
If your dataset is small enough you may try to use Velvet with multiple k-mers (see page 7 in the manual).

Quote:
Originally Posted by nxtgenkid10 View Post
2 : Which Files i have to see for the # of contigs formed by a particular set of parameters
You can always just use
Code:
grep -c ">" contigs.fasta
This works for all assemblies in fasta-format.

When using Velvet you get the Log file which tells you something like:
Code:
Median coverage depth = X
Final graph has X nodes and n50 of X, max X, total X, using X/X reads
nangillala is offline   Reply With Quote
Old 02-24-2012, 01:43 AM   #3
nxtgenkid10
Member
 
Location: india

Join Date: Feb 2011
Posts: 16
Default

Quote:
Originally Posted by nangillala View Post
Hi,

Let me cite the Velvet Manual here:
You can read a bit more on page 16 of the Velvet Manual. There's a lot of discussion about the choice of k-mers in publications and on this forum.
If your dataset is small enough you may try to use Velvet with multiple k-mers (see page 7 in the manual).


You can always just use
Code:
grep -c ">" contigs.fasta
This works for all assemblies in fasta-format.

When using Velvet you get the Log file which tells you something like:
Code:
Median coverage depth = X
Final graph has X nodes and n50 of X, max X, total X, using X/X reads
What my problem is with that only

I used the k-mer to be 15 in velveth and in velvetg -cov_cutoff auto -exp_cov auto -ins_length 1000 -exp_cov 5

so as far as my understanding the contig.fa should have vaule greater than 2k in my case 30 but my files have such entries too y is it so and yu can notice as in below cov is 0.000 tooo

>NODE_9_length_21_cov_0.000000
GGGAACCGACATGAGGAACTTAGCACGGTAAACAG
>NODE_18_length_23_cov_0.000000
CCCGCGTTCAGACGCAGTTCAGACATATGGTGGACCG
>NODE_24_length_16_cov_0.000000
GGTTAAGAGCCTGCTACGCAGGCTCTTAAC
>NODE_39_length_31_cov_0.000000
TGCGCGCTGGCCAGACCGGCTTGTGCGCTGCGCAGCTGAGCGTTT
>NODE_56_length_15_cov_0.000000
CTGTCTATCAGCTGTCTCTCTTCAAGCGC
>NODE_66_length_29_cov_0.000000
CGATAACGCGCTGCCACTGACGACAGTCCAGGGTATCTCCCTC
nxtgenkid10 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:24 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO