SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
libgtextutils installation problem for FASTX toolkit jazz Bioinformatics 45 10-13-2014 03:43 AM
Methodology used by Fastx clipper babi2305 Bioinformatics 0 02-13-2013 11:50 AM
FastX: fastq_quality_filter problem ElMichael Bioinformatics 11 11-08-2012 11:19 PM
Amplicon sequencing remove primer & adapters wzhang1001 Bioinformatics 4 07-19-2012 10:32 AM
Process to remove primers, adapters, etc. from Illumina data LizBent Bioinformatics 6 05-14-2012 04:08 AM

Reply
 
Thread Tools
Old 11-11-2013, 02:13 AM   #1
mihuzx
Member
 
Location: Beijing China

Join Date: Apr 2013
Posts: 20
Smile fastx-clipper to remove adapters problem

Hi everyone,
today I tried to remove adapters using fastx-cliper, it worked all right, but the result is a little confused. here is the situation:
first I check the sequence quality using fastqc, and it said there is an Overrepresented sequences
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGAGATCTATCTCGT, 7500 counts, and the Possible Source is TruSeq Adapter, Index 5 (97% over 37bp).
so I want to remove the adapter using fastx-cliper. and the command is
fastx_cliper -a Adaper_seq -C -i input.fastq -o outfile.fastq
but it removed much more than 7500 reads (about 20000 reads), and it also trimmed many other reads whitch contain part of the adapter. so the outputfile contain all length reads instead of equal lengh reads. in addition, it also remove a lot of short (<5bp) reads, but the reads in input file were all equal.
there must be something wrong, and did I used the wrong parameters? could I only remove the reads containing the whole adapter? and if I want to do so, can the fastx-toolkit do this job? or is there some other tools to recommend

thanks a lot!
mihuzx is offline   Reply With Quote
Reply

Tags
fastx_clipper, remove adapters

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:46 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO