SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > 454 Pyrosequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
extract data from fasta-files with perl?? anna_ Bioinformatics 20 02-17-2016 07:29 AM
sff files, fasta and fastq Feenix 454 Pyrosequencing 4 06-26-2014 05:43 AM
Consensus FASTA from BAM files mixter Bioinformatics 14 05-19-2014 09:07 AM
sff 454 files into fasta Peruano 454 Pyrosequencing 4 03-08-2010 01:21 PM
Where to download SNP FASTA files from dbSNP CarlElit Bioinformatics 1 11-18-2009 01:49 AM

Reply
 
Thread Tools
Old 12-16-2010, 04:32 AM   #1
jordi
Member
 
Location: València, Spain

Join Date: Apr 2009
Posts: 48
Default 454 fasta files

Hi all,
I'm a bit confused with the 454 fasta output files after a sequencing run. Below you have an example what I got. According to that my 454 knowledge, capital letters were those with the higher quality scores, i.e. lowercase bases where those trimmed or filtered. But what about those lowercase bases with high quality scores?? (for instance those in bold).
Finally I tried to perform an assembly process from the second fasta file, bu I suspect lost a lot of information.
What do you think?
Thanks a lot.
>FF56QEU12HGEH6
tcagGGGGTAGGCAACCCAAAACACTCAAAGAGCCACTTGGACCC
GTTTCCCACCGAAAACAAACACTGGGAGCCTTTTGGATCTAAAATGAAGATATTA
TTATTATTATTATTATTTATTAAATTTCatgccgccctattccggaaactcaggg
cgataacactgcagatatccttttttaccttaangtgtgtgtgtgtgtgtgtctt
tgtgttgtatatataaataaaggtaaaaaggatatatgcagtgttatcttctatt
tggtatgtacgtaaaacggg

>uaccno=FF56QEU12HGEH6
GGGGTAGGCAACCCAAAACACTCAAAGAGCCACTTGGACCCGTTTCCCACCGAAAACAAACACTGGGAGCCTTTTGGATCTAAAATGAAGATATTATTATTATTATTATTAT
TTATTAAATTTC

>FF56QEU12HGEH6
32 32 32 32 31 31 31 31 32 32 17 17 36 33 33 30 30 30 20 20 20 20 29 22 30 33 32 32 33 33 37 37 40 36 36 36 37 37 37 32 32 32 28 28 28 32 31 30 29 13 13 13 27 19 15 23 13 13 13 13 15 9 9 9 15 11 24 26 23 23 23 26 18 26 26 22 23 23 23 18 18 18 27 31 30 30 30 30 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 30 30 30 30 28 28 28 28 28 24 25 13 13 13 13 11 11 13 16 25 13 13 13 21 21 28 30 31 31 30 17 17 17 30 32 32 30 30 30 30 30 30 17 17 17 26 26 29 15 15 17 22 17 21 26 26 26 26 26 26 26 30 28 23 23 23 23 23 23 13 13 13 13 13 13 13 13 13 13 16 9 9 23 23 0 24 26 29 30 30 30 30 30 29 28 28 28 26 26 24 21 15 15 15 12 12 11 17 11 20 20 11 11 11 11 11 20 20 17 17 11 11 11 11 11 11 11 17 17 17 11 11 11 9 9 11 11 7 16 15 15 15 11 11 11 11 11 16 15 15 18 16 15 16 11 11 11 11 16 13 13 13 16 16 11 11 13 13 18 22 22 22 22 21 21 21 21 22 22 22 22
jordi is offline   Reply With Quote
Reply

Tags
454, fasta file, trimmed reads

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:01 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO