SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Multireads reported as unique by Tophat xibarra RNA Sequencing 2 05-21-2014 02:01 AM
STAR-alignment/confusion with mismatches & multi-mapping parameter babi2305 Bioinformatics 9 05-07-2013 12:45 PM
Crest reported only one somatic SV ourgenome Bioinformatics 0 07-13-2012 01:01 AM
GATK reported AD and DP spreeth84 Bioinformatics 1 03-28-2012 07:43 AM
Global Alignment With Mummer (Parameter for Gap Extension & Opening Cost) peveralldubois Bioinformatics 0 03-06-2011 11:45 PM

Reply
 
Thread Tools
Old 07-29-2014, 11:45 AM   #1
AnneBiton
Junior Member
 
Location: California

Join Date: Aug 2012
Posts: 5
Default STAR: Alignment reported with less matches than parameter --outFilterMatchNmin

Hello,

I am using STAR_2.3.0e.Linux_x86_64 to align only the first 25b of my paired-end reads, with the parameters:
--outFilterMatchNmin 40

--clip5pNbases 4 (there 4 random pairs before the PCR primer that I want to remove)

--clip3pNbases 71 (in order to only keep the first 25 bases)

--outSAMattributes All

--outFilterMultimapNmax 3

--outFilterMismatchNmax 5

--outFilterMismatchNoverLmax 0.05

--alignIntronMax 1

--alignMatesGapMax 740

I have cases like below where one mate of a pair is multiply mapped but with alignments containing a sum of matches that is less than 40, although I asked for a minimum of 40 matches using the parameter --outFilterMatchNmin.

I don't understand why these alignments are recorded while they have less than 40 perfect matches (required using --outFilterMatchNmin).

Any advice or guidance will be welcomed, thank you!

Best,
Anne

HISEQ:97:H8U2HADXX:1:1101:3459:2064 355 CXCL3 328 3 4S25M71S = 428 111 AATTATGACAGGGTGGGGAACTGGAGGGTGGGGGGATTGAAATGCAAGCAATTAGTGGATCACTGTTAGGGTAAGGGAATGTATGTACACATCTATTTTT @C@DDFFFHHGGFACHEGIGGIGIHIII?DHIJJD8BDCDDCDDDDCCDDDDDCCDDDCDABDDDDDDDDD9ACCDDBDDDCCCD>B>CCCCDCDEEEED NH:i:2 HI:i:2 AS:i:34 nM:i:0 jM:B:c,-1 jI:B:i,-1

HISEQ:97:H8U2HADXX:1:1101:3459:2064 403 CXCL3 428 3 81S11M8S = 328 -111 TTTGCTTTATAGGTTATTTTATTTTTATTTCTCTAATTCCTGGGTTTTTTTTTTTCTCTTAAAAAAAATATTTTTTATTTTCTTTTTTTTTATTGCCTTT #################################################################################################### NH:i:2 HI:i:2 AS:i:34 nM:i:0 jM:B:c,-1 jI:B:i,-1
AnneBiton is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:28 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO