SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
GATK to discover Single Nucleotide Variation in mature miRNA from miRNA-Seq Bioinfo83 Bioinformatics 0 01-31-2012 04:11 AM
miRNA-Seq with samples that have different % miRNA to Total RNA... DrDTonge Bioinformatics 0 01-12-2012 11:20 PM
Trouble indexing reference db for BFAST jmartin Bioinformatics 8 08-19-2011 09:05 AM
novel plany miRNA prediction without reference Giorgio C Bioinformatics 3 05-23-2011 02:25 AM
bfast localalign looking for the wrong reference file baldeberre Bioinformatics 16 09-17-2010 01:56 PM

Reply
 
Thread Tools
Old 10-22-2009, 09:10 AM   #1
m_elena_bioinfo
Member
 
Location: Ospedali Riuniti di Bergamo, ITALY

Join Date: Oct 2009
Posts: 99
Default BFAST and miRNA precursor reference

Dear users,
I'm using BFAST to align miRNA reads from SOLiD ABI to the precursor miRNA reference.

I can't understand one thing.

When I used the reference of miRNA precursor as (for example):
>hsa-mir-548d-1 MI0003668 Homo sapiens miR-548d-1 stem-loop
AAACAAGUUAUAUUAGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCCUGUAAAAGUAAUGG
CAAAAACCACAGUUUCUUUUGCACCAGACUAAUAAAG
>hsa-mir-661 MI0003669 Homo sapiens miR-661 stem-loop
GGAGAGGCUGUGCUGUGGGGCAGGCGCAGGCCUGAGCCCUGGUUUCGGGCUGCCUGGGUC
UCUGGCCUGCGCGUGACUUUGGGGUGGCU
...
...

(extracted by miRBasev13)
the program returns me the error at the localalign step saying me that read and reference don't match.

If I use the same reference, adding to each miRNA sequence 35 N (at the begin and at the end of each one), as, for example:

>hsa-mir-1277
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTCCCAAATATATATATATATGTACGTATGTGTATATAAATGTATACGTAGATATATATGTATTTTTGGTGGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>hsa-mir-1278
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGCTCATAGATGATATGCATAGTACTCCCAGAACTCATTAAGTTGGTAGTACTGTGCATATCATCTATGAGCGAATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
...
...

the program runs and I can terminate my alignment.

So, I don't know how to explain it to myself!

I then compared the number of counts found by BFAST program (about 75000) with the counts found by the RNA_pipeline of corona lite (ABI) (about 22000).
How can I explain this so large difference?
Thank you very much for the help!

Maria Elena
m_elena_bioinfo is offline   Reply With Quote
Old 10-24-2009, 07:34 PM   #2
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by m_elena_bioinfo View Post
Dear users,
I'm using BFAST to align miRNA reads from SOLiD ABI to the precursor miRNA reference.

I can't understand one thing.

When I used the reference of miRNA precursor as (for example):
>hsa-mir-548d-1 MI0003668 Homo sapiens miR-548d-1 stem-loop
AAACAAGUUAUAUUAGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCCUGUAAAAGUAAUGG
CAAAAACCACAGUUUCUUUUGCACCAGACUAAUAAAG
>hsa-mir-661 MI0003669 Homo sapiens miR-661 stem-loop
GGAGAGGCUGUGCUGUGGGGCAGGCGCAGGCCUGAGCCCUGGUUUCGGGCUGCCUGGGUC
UCUGGCCUGCGCGUGACUUUGGGGUGGCU
...
...

(extracted by miRBasev13)
the program returns me the error at the localalign step saying me that read and reference don't match.

If I use the same reference, adding to each miRNA sequence 35 N (at the begin and at the end of each one), as, for example:

>hsa-mir-1277
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTCCCAAATATATATATATATGTACGTATGTGTATATAAATGTATACGTAGATATATATGTATTTTTGGTGGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>hsa-mir-1278
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGCTCATAGATGATATGCATAGTACTCCCAGAACTCATTAAGTTGGTAGTACTGTGCATATCATCTATGAGCGAATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
...
...

the program runs and I can terminate my alignment.

So, I don't know how to explain it to myself!

I then compared the number of counts found by BFAST program (about 75000) with the counts found by the RNA_pipeline of corona lite (ABI) (about 22000).
How can I explain this so large difference?
Thank you very much for the help!

Maria Elena
What version are you using? What post processing options are you using?
nilshomer is offline   Reply With Quote
Old 10-25-2009, 03:59 AM   #3
m_elena_bioinfo
Member
 
Location: Ospedali Riuniti di Bergamo, ITALY

Join Date: Oct 2009
Posts: 99
Default

Thanks Dr.Homer,
I'm using bfast-0.6.0d

The options and the parameters, after the fasta2brg and the index step, that I use are:

> bfast match -f hsa_human.fa -r file.fastq -A 1 > file.bmf

> bfast localalign -f hsa_human.fa -m file.bmf -A 1 > file.baf

> bfast postprocess -f hsa_human.fasta -a 3 -O 3 -i file.baf -A 1 > output.sam

With fasta file without NNN, the program crashes at localalign step.
m_elena_bioinfo is offline   Reply With Quote
Old 10-25-2009, 10:07 AM   #4
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by m_elena_bioinfo View Post
Thanks Dr.Homer,
I'm using bfast-0.6.0d

The options and the parameters, after the fasta2brg and the index step, that I use are:

> bfast match -f hsa_human.fa -r file.fastq -A 1 > file.bmf

> bfast localalign -f hsa_human.fa -m file.bmf -A 1 > file.baf

> bfast postprocess -f hsa_human.fasta -a 3 -O 3 -i file.baf -A 1 > output.sam

With fasta file without NNN, the program crashes at localalign step.
Only valid DNA bases are allowed as well as N (so only ACGTN). It looks like you have Us in the reference for the miRNA. Convert those to Ts in your reference.
nilshomer is offline   Reply With Quote
Old 10-27-2009, 03:27 AM   #5
m_elena_bioinfo
Member
 
Location: Ospedali Riuniti di Bergamo, ITALY

Join Date: Oct 2009
Posts: 99
Default

Dr. Homer,
in my reference there are not U but it contains only DNA bases. For example:

>hsa-let-7a-2
AGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACATCAAGGGAGATAACTGTACAGCCTCCTAGCTTTCCT
>hsa-let-7a-3
GGGTGAGGTAGTAGGTTGTATAGTTTGGGGCTCTGCCCTGCTATGGGATAACTATACAATCTACTGTCTTTCCT

So, I don't think that this is the problem!
m_elena_bioinfo is offline   Reply With Quote
Old 10-27-2009, 08:21 AM   #6
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by m_elena_bioinfo View Post
Dr. Homer,
in my reference there are not U but it contains only DNA bases. For example:

>hsa-let-7a-2
AGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACATCAAGGGAGATAACTGTACAGCCTCCTAGCTTTCCT
>hsa-let-7a-3
GGGTGAGGTAGTAGGTTGTATAGTTTGGGGCTCTGCCCTGCTATGGGATAACTATACAATCTACTGTCTTTCCT

So, I don't think that this is the problem!
Give me your reference and a set of reads an I will test it out myself. Thanks!

Nils
nilshomer is offline   Reply With Quote
Old 01-04-2011, 07:49 AM   #7
rdeborja
Member
 
Location: Toronto

Join Date: Aug 2008
Posts: 42
Default

Has anyone tried aligning to the mature sequences instead of the entire precursor using BFAST. I've recently jumped on the BFAST bandwagon for genomic data and am trying to find out whether miRNA is feasible. I have two approaches: 1. align to only the mature sequences to identify the known sequences, 2. align to the entire genomic reference and look up and down 100bp of the aligned position for a second hit in the reverse compliment to identify a potential loop structure.
rdeborja is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:48 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO