Hi all,
I have some sequencing output from an Illumina Solexa machine. It looks like Gerald was run using "ANALYSIS eland_extended" and the output is mapped to the human genome (though I'm not completely sure). ex:
HWI-EAS344 90324 3 86 1654 1007 0 1 TTTTGAGCCCAGGAGATTCATGCTGAAGAGCTAGG aaaa[a]]X_aYYa[^`_]`_WU]N^]SXUUX^RU chr10.fa 103778 R 35 28
Is there any way I can quickly convert this into a format that's viewable as a histogram? Like on the UCSC genome browser? Or a program that can run through this data and produce a histogram?
-Kevin
I have some sequencing output from an Illumina Solexa machine. It looks like Gerald was run using "ANALYSIS eland_extended" and the output is mapped to the human genome (though I'm not completely sure). ex:
HWI-EAS344 90324 3 86 1654 1007 0 1 TTTTGAGCCCAGGAGATTCATGCTGAAGAGCTAGG aaaa[a]]X_aYYa[^`_]`_WU]N^]SXUUX^RU chr10.fa 103778 R 35 28
Is there any way I can quickly convert this into a format that's viewable as a histogram? Like on the UCSC genome browser? Or a program that can run through this data and produce a histogram?
-Kevin
Comment