BWA output interepretation

seq_GA · 06-09-2010, 08:39 PM

Hi,
I am finding bit difficulties in understading BWA output format (with indels) and following are my queries.

Code:

GA1_0001:5:1:2237:4692#0    0       chr8    145553847       37      70M1I4M *       0       0       GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG
GTGAGTGGGAGGGAGGTGCAGGTGTAGATC     00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%     XT:A:U  NM:i:3  X0:i:1  X1:i:0  XM
:i:3  XO:i:1  XG:i:1  MD:Z:71C0C1

1. XT:A:U means unique hits and XT:A:R means repeat..
2. The above query has the desciptor as 70Match, 1 insertion and 4 matches (75 bp query). If I go to UCSC blat to check this part, first 70 bases matches with the ref (hg18) sequnces and the last GATC is not in that position followed by an insertion in 71st position. Its bit confusing at this stage.
3. How to intrepret

Code:

XO:i:1  XG:i:1

Number of gaps and gap extentions. If my understanding is correct, it opens 1 gap and extended to 1 base. I am trying to understnad the above read results.
3. Sometimes BWA gives XA: (alternate hits) for XT:A:R (multiple hits). Is tehre any threshold for BWA to report these alternate hits. Sometimes I see X0:i:10 ( number of best hits as 10) but alternate hits reports only 3 or 4. Is there any threshold to report alternate hits as I believe BWA doesnot report all alternate hits for every multiple hits.
4. I also want to know about the mismatch tag

Code:

MD:Z:71C0C1

explanation.

I would appreciate very much if someone could explain my above queries. Thanks.

seq_GA · 06-09-2010, 10:30 PM

Another example which has both deletions as well as insertion as below:

Code:

GA1_0001:5:1:2203:13069#0   0       chr7    143975167       37      68M1D4M2I1M     *       0       0       TCCATCACTGATCAAGAGTGGGGTGGCAGGTATTAGG
GATAATATTCATTTAGCTTTCTGAGCTTTCTGAGATCG     CCCCCCCCCCCCCCCCCCCDCCCCCBBCCCACCCCCCCCCCCCCCCCCCCCCCCCC@CCCCCCCCCCBCACCCCC     XT:A:U  NM:i:4  X0:i:1  X1
:i:0  XM:i:3  XO:i:1  XG:i:1  MD:Z:68^G1G3

How do I intrepret the above result. Thanks.

seq_GA · 06-13-2010, 06:07 PM

Can anyone comment on my queries above? Thx.

nilshomer · 06-13-2010, 08:03 PM

Quote:

Originally Posted by seq_GA

Can anyone comment on my queries above? Thx.

Sorry for my own impatience, but the answers can be found in the SAM spec and BWA manual.

seq_GA · 06-14-2010, 01:23 AM

I did go through the manual and still couldn't figure out whether gap opened and extended are real one of any artifact as I am trying to validate the results.

As I mentioned below

Code:

GA1_0001:5:1:2237:4692#0    0       chr8    145553847       37      70M1I4M *       0       0       GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG
GTGAGTGGGAGGGAGGTGCAGGTGTAGATC     00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%     XT:A:U  NM:i:3  X0:i:1  X1:i:0  XM
:i:3  XO:i:1  XG:i:1  MD:Z:71C0C1

I can't figure out MD:Z:71C0C1 and also, 1 gap is opened and extended one bp. But when I blat the same sequence in UCSC blat, its a perfect match.

And tehre are some example as below whether both insertions and deletion occur in the same read. Is it possible? Thanks.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Problems with BWA XA output on	kbhit	General	1	02-29-2012 02:16 PM
the output of bwa	milkingroom	Bioinformatics	1	09-21-2011 02:48 PM
Question on BWA output	rboettcher	Bioinformatics	3	04-18-2011 04:21 AM
bwa output	scami	Bioinformatics	1	12-22-2010 03:10 AM
output all possible match using bwa	mingkunli	Bioinformatics	2	09-05-2009 09:06 AM

06-09-2010, 08:39 PM	#1
seq_GA Senior Member Location: Asiana Join Date: Feb 2009 Posts: 124	BWA output interepretation Hi, I am finding bit difficulties in understading BWA output format (with indels) and following are my queries. Code: GA1_0001:5:1:2237:4692#0 0 chr8 145553847 37 70M1I4M * 0 0 GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG GTGAGTGGGAGGGAGGTGCAGGTGTAGATC 00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% XT:A:U NM:i:3 X0:i:1 X1:i:0 XM :i:3 XO:i:1 XG:i:1 MD:Z:71C0C1 1. XT:A:U means unique hits and XT:A:R means repeat.. 2. The above query has the desciptor as 70Match, 1 insertion and 4 matches (75 bp query). If I go to UCSC blat to check this part, first 70 bases matches with the ref (hg18) sequnces and the last GATC is not in that position followed by an insertion in 71st position. Its bit confusing at this stage. 3. How to intrepret Code: XO:i:1 XG:i:1 Number of gaps and gap extentions. If my understanding is correct, it opens 1 gap and extended to 1 base. I am trying to understnad the above read results. 3. Sometimes BWA gives XA: (alternate hits) for XT:A:R (multiple hits). Is tehre any threshold for BWA to report these alternate hits. Sometimes I see X0:i:10 ( number of best hits as 10) but alternate hits reports only 3 or 4. Is there any threshold to report alternate hits as I believe BWA doesnot report all alternate hits for every multiple hits. 4. I also want to know about the mismatch tag Code: MD:Z:71C0C1 explanation. I would appreciate very much if someone could explain my above queries. Thanks.

06-14-2010, 01:23 AM	#5
seq_GA Senior Member Location: Asiana Join Date: Feb 2009 Posts: 124	I did go through the manual and still couldn't figure out whether gap opened and extended are real one of any artifact as I am trying to validate the results. As I mentioned below Code: GA1_0001:5:1:2237:4692#0 0 chr8 145553847 37 70M1I4M * 0 0 GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG GTGAGTGGGAGGGAGGTGCAGGTGTAGATC 00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% XT:A:U NM:i:3 X0:i:1 X1:i:0 XM :i:3 XO:i:1 XG:i:1 MD:Z:71C0C1 I can't figure out MD:Z:71C0C1 and also, 1 gap is opened and extended one bp. But when I blat the same sequence in UCSC blat, its a perfect match. And tehre are some example as below whether both insertions and deletion occur in the same read. Is it possible? Thanks.

06-13-2010, 06:07 PM	#3
seq_GA Senior Member Location: Asiana Join Date: Feb 2009 Posts: 124	Can anyone comment on my queries above? Thx.