Hi everyone
Im ending my work and i have a problem, how can i make that my multi-fasta file with the query sequence has a descriptions using the annotations hits that i get from blast, here is and example:
>CL44Contig4 Nascent polypeptide associated complex alpha
ACACGACGACTTCGAGCGGCCGAACCCGGGCAGGTACGAACGGGGGGCAAGCTA
Anyone try to make this before???
Im ending my work and i have a problem, how can i make that my multi-fasta file with the query sequence has a descriptions using the annotations hits that i get from blast, here is and example:
>CL44Contig4 Nascent polypeptide associated complex alpha
ACACGACGACTTCGAGCGGCCGAACCCGGGCAGGTACGAACGGGGGGCAAGCTA
Anyone try to make this before???
Comment