reg fastq extraction

[reena_narayanan]

Dear All,

I have a 5GB fastq file, i want to know how I can extract the sequence from it. Kindly let me know the script to extract sequence. thanks in advance.

Reena.

[ritzriya]

Dear All,

I have a 5GB fastq file, i want to know how I can extract the sequence from it. Kindly let me know the script to extract sequence. thanks in advance.

Reena.

I think you are not using Linux that is why you are not aware of how this is to be done.
Example input of fastq:
@07LH_20080515:7:1:100:783
TTTGATGATTTCGACTTTGATAATTTGC
+07LH_20080515:7:1:100:783
WWWWWWWWWWWWWWWWWWWWWWWWWWWG

Command to get only sequences:
paste - - - - inputfile | awk '{print $2}' > outputfile

[reena_narayanan]

FastaQ extraction script

Thanks for your reply. Actually i have a 2 GB fastq file. I wanted to know if there is any script to extract the sequences in fasta format.
thanks,
Reena

[ritzriya]

For fasta file output:

paste - - - - inputfile | awk '{print ">"$1"\n"$2}' > outputfile

[gaffa]

Alternatively use the converter in the FASTX package: http://hannonlab.cshl.edu/fastx_toolkit/