SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Count the Number of Paired-End Reads Mapped by Tophat Fernas Bioinformatics 5 10-23-2015 03:26 AM
Count number of reads in peaks? albireo Bioinformatics 4 04-13-2013 07:51 PM
How to count number of mapped paired-end and single-end rna-seq reads repinementer Bioinformatics 8 01-06-2013 06:06 AM
Count unique reads in a FASTQ file id0 Bioinformatics 2 10-24-2012 02:01 AM
cufflinks with collapsed reads files SongLi Bioinformatics 0 11-19-2010 12:10 PM

Reply
 
Thread Tools
Old 07-30-2013, 10:06 AM   #1
lran2008
Member
 
Location: quebec

Join Date: Apr 2013
Posts: 35
Default count reads number in collapsed file

Hi all,

I used bowtie to align a collapsed fasta file to the bovine genome and get a fasta file (mapped.fa) including all the mapped reads. But this mapped.fa is also a collapsed file. So how could I get the total reads number in mapped.fa, instead of the unique reads number?

Thanks.

Ran
lran2008 is offline   Reply With Quote
Old 07-30-2013, 10:43 AM   #2
Heisman
Senior Member
 
Location: St. Louis

Join Date: Dec 2010
Posts: 535
Default

What do you mean by "collapsed"? Could you copy and paste the exact commands that were run?
Heisman is offline   Reply With Quote
Old 07-30-2013, 11:34 AM   #3
lran2008
Member
 
Location: quebec

Join Date: Apr 2013
Posts: 35
Default

Hi Heisman, thanks for your reply. The collapsed file included the unique reads:

>1-30176523
TCAGTGCACTACAGAACTTTGT
>2-17234938
TTCAAGTAATCCAGGATAGGCT
>5-10273189
TACCCTGTAGAACCGAATTTGT
>6-10202799
TGAGATGAAGCACTGTAGCT
>7-7833696
TGAGATGAAGCACTGTAGCTCT
>8-7677783
TGTAAACATCCTCGACTGGA
>9-7403197
TGTAAACATCCTCGACTGGAAGCT
>10-5760993
TGGGGGGCCCAAGTCCTTCTGATCGAGGCC

So here I can get the number of total unique reads. But each unique read represents thousands of reads. How could I get the total number of the redundant reads in this file?

Thanks!
lran2008 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:36 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO