SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Flongle flow cells - now shipping gringer Oxford Nanopore 0 10-19-2018 03:43 PM
Flow cells Shaia Suki Wong General 7 02-17-2016 07:02 AM
Is US$9600 cheap for one flow cell 2x100 rapid mode on HiSeq 2500 ymc Service Providers 19 12-04-2013 02:23 PM
Fast flow cells and Allpaths troendle Bioinformatics 3 10-31-2013 11:16 AM

Reply
 
Thread Tools
Old 02-17-2020, 11:49 PM   #1
arikogran
Junior Member
 
Location: Tel Aviv

Join Date: Feb 2020
Posts: 1
Default SR Rapid V2 compared to SR V3/V4 flow cells

Hello,
I have custom CAGE library that was designed to be compatible with SR HO V3 and V4 flow cells. Due to custom seq. primer I can't share the 8 lanes with anyone. My best option is to use the two lanes of SR Rapid V2, does anyone knows whether P5/P7 sequences are the same as in SR V3/V4?
I found non formal documentation (from 2019) that shows the minimum P5/P7 sequences required for SR ONLY flow cells:
P5: 5' AATGATACGGCGACCACCGA 3'
P7: 5' CAAGCAGAAGACGGCATACGA 3'
Does anyone knows whether this information is still relevant? and in what kit?
Thanks
arikogran is offline   Reply With Quote
Old 02-18-2020, 12:08 PM   #2
misterc
Member
 
Location: Livermore, CA

Join Date: Jan 2016
Posts: 44
Default

Hi,

You could use the custom primer position on the cBot when clustering a HO v3 or v4 flow cell. For the other samples going on the flow cell, move the read primer from the cBot plate to the custom primer position for those other lanes.
misterc is offline   Reply With Quote
Reply

Tags
ho v4, p5 p7 sequences, rapid, sr flow cell

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:35 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO