SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
PCR primers+adaptors gio5 Sample Prep / Library Generation 2 01-05-2012 09:32 AM
small RNA Truseq library sequencing primers deepakpatilp Illumina/Solexa 0 08-26-2011 01:22 AM
TruSeq Sample Prep, Enrichment PCR primer sequences EdibleMetal Sample Prep / Library Generation 11 04-13-2011 11:15 AM
Excess PCR primers in final product PaulineF Illumina/Solexa 19 07-27-2010 04:23 AM
Number of PCR How many PCR cycles to enrich adapter-modified DNA fragments MGH Man Sample Prep / Library Generation 5 07-26-2010 05:15 AM

Reply
 
Thread Tools
Old 06-28-2011, 06:35 AM   #1
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 308
Default TruSeq compatible PCR primers

I'm doing ChIP-seq and would like to start using the TruSeq Adaptors for barcoding (single read). I have the sequences of the TruSeq adaptors from Illumina but they do not give out the sequences of the PCR primers.

Has anyone made their own PCR primers that work with the TruSeq adaptors?

If it's not illegal to post this trade secret, does anyone know the sequence of the Illumina PCR primers for TruSeq?
ETHANol is offline   Reply With Quote
Old 06-28-2011, 12:47 PM   #2
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,177
Default

Illumina does not want the information posted to public forums but will provided it to you simply by asking. See this thread (post #4 in particular) for further details:

http://seqanswers.com/forums/showthread.php?t=8564
kmcarr is offline   Reply With Quote
Old 06-28-2011, 01:19 PM   #3
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 308
Default

They give out the sequences for the adaptor primers but not the PCR primers. Or at least that is the file they gave me.
ETHANol is offline   Reply With Quote
Old 07-03-2011, 12:38 AM   #4
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 308
Default

Somebody must be making their own TruSeq PCR primers (PCR Primer Cocktail as Illumina calls it).

Anyway, after looking at the old and new adaptor sequences, I was going to give the following primers a try:

5' aatgatacggcgaccaccga*g
5' CAAGCAGAAGACGGCATACGA*G
*=phosphothiorylate bond

Seems like it should work. Anybody have any opinion?

Last edited by ETHANol; 07-03-2011 at 01:04 AM. Reason: edited to correct a typing error in the second primer sequence
ETHANol is offline   Reply With Quote
Old 07-06-2011, 05:00 AM   #5
bbeitzel
Member
 
Location: Ft. Detrick, MD

Join Date: Aug 2008
Posts: 50
Default

Those look OK according to my understanding of the final library fragments. I don't think you need the phosphorothioate linkages, though.
bbeitzel is offline   Reply With Quote
Old 07-06-2011, 06:25 AM   #6
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 308
Default

Thanks. I put the order in. We'll see if it works.

The phosphorotiolation is suppose to increase efficiency with proofreading polymerases. Maybe it's not necessary but it couldn't hurt.
http://nar.oxfordjournals.org/conten.../3551.abstract

I also Googled my primer sequences and found this:
http://openwetware.org/images/1/10/Geller_exome.pdf

So it seems like it should work.
ETHANol is offline   Reply With Quote
Old 07-06-2011, 06:35 AM   #7
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,317
Default

Quote:
Originally Posted by ETHANol View Post
Thanks. I put the order in. We'll see if it works.

The phosphorotiolation is suppose to increase efficiency with proofreading polymerases. Maybe it's not necessary but it couldn't hurt.
http://nar.oxfordjournals.org/conten.../3551.abstract
[...].
Just to be clear:
The phosphorothioate linkages are not susceptible to (or are less susceptible to?) exo-nucleolytic enzymes.

The hallmark of a high fidelity enzyme is a 3'->5' exonuclease activity. So there is a connection there. But really the idea is that if your adapters have 3' overhangs that you don't want to get nibbled back by "end polishing" enzymes (eg T4 polymerase) that did not get completely removed/deactivated in an earlier step, then you put in the phosphorothioate linkages.

--
Phillip
pmiguel is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:18 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO