SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
PCR Enrichment - Replace TruSeq PPC and PMM?! Akira Illumina/Solexa 3 03-09-2012 06:57 AM
PCR primers+adaptors gio5 Sample Prep / Library Generation 2 01-05-2012 09:32 AM
TruSeq compatible PCR primers ETHANol Illumina/Solexa 6 07-06-2011 06:35 AM
TruSeq Sample Prep, Enrichment PCR primer sequences EdibleMetal Sample Prep / Library Generation 11 04-13-2011 11:15 AM
Excess PCR primers in final product PaulineF Illumina/Solexa 19 07-27-2010 04:23 AM

Reply
 
Thread Tools
Old 11-19-2012, 12:09 PM   #1
seangallaher
Junior Member
 
Location: CA

Join Date: Sep 2011
Posts: 5
Default TruSeq PCR enrichment primers

Does anyone know the sequences of the PCR enrichment primers from the Illumina TruSeq kit (the PPC primers)? I have the adaptor sequences, so I know what the 5' end of each sequence should be, but I don't know how long they are.

Additional info:
I tried the sequences from the OpenWetWare protocol in this thread:
http://seqanswers.com/forums/showthread.php?t=12342
They are as follows:
P5_PCR: AATGATACGGCGACCACCGAG
P7_PCR: CAAGCAGAAGACGGCATACGAG
These do amplify the library, but they are very inefficient compared to the PPC primers in the kit.

I have seen other examples of primers in the literature that are longer. However, the longer ones that I have seen include the region of P7 where the index is. I hope I do not need to make a separate P7 primer for each index in order to preserve my ability to multiplex. I'm sure that is not how the PPC primers work.

Thanks!

Sean
seangallaher is offline   Reply With Quote
Old 11-20-2012, 12:18 PM   #2
ageneheo
Junior Member
 
Location: CA

Join Date: Sep 2012
Posts: 4
Default Re:

Hi seangallaher,

I need to order Truseq PCR primers soon.

Could you provide a gel picture of PCR amplified P5 & P7 PCR primers and PPC primers?

Thanks,
ageneheo is offline   Reply With Quote
Old 11-20-2012, 12:39 PM   #3
kwaraska
Senior Member
 
Location: Boston,MA

Join Date: Nov 2008
Posts: 122
Default From a paper

We use the sequences we got from a paper by Geller from April 2011. I was only given the appendix so I am not sure but I assume the paper is called "High Throughput Indexed Library Preparation and Pooled Agilent Exome Enrichment" It has the sequences of the PCR primers as well as the adapter sequences. We use them here and they work very well.

That being said-can I say that they re exactly what is in the Illumina primer cocktail-no, but they work for us and we are a core facility so we make many libraries.
kwaraska is offline   Reply With Quote
Old 11-20-2012, 12:53 PM   #4
ageneheo
Junior Member
 
Location: CA

Join Date: Sep 2012
Posts: 4
Default

Hi Kwaraska,

Do you use PCR primers with phosphorothilated modification?
ageneheo is offline   Reply With Quote
Old 11-20-2012, 12:54 PM   #5
kwaraska
Senior Member
 
Location: Boston,MA

Join Date: Nov 2008
Posts: 122
Default PCR primers

No the PCR primers we just use HPLC purified, but we do add the phosphothioate to the adapters.
kwaraska is offline   Reply With Quote
Old 11-21-2012, 08:37 AM   #6
seangallaher
Junior Member
 
Location: CA

Join Date: Sep 2011
Posts: 5
Default

Quote:
Originally Posted by ageneheo View Post
Hi seangallaher,

I need to order Truseq PCR primers soon.

Could you provide a gel picture of PCR amplified P5 & P7 PCR primers and PPC primers?

Thanks,
Here is a PCR reaction I did on a qPCR thermocycler with added SYBR green. I used Phusion polymerase with the P5/P7 primers vs. the Illumina reagents and the same template. The Phusion reaction is retarded by over 11 cycles!
Attached Images
File Type: png for SeqAnswers.png (127.2 KB, 71 views)
seangallaher is offline   Reply With Quote
Old 11-21-2012, 08:45 AM   #7
seangallaher
Junior Member
 
Location: CA

Join Date: Sep 2011
Posts: 5
Default

Quote:
Originally Posted by kwaraska View Post
We use the sequences we got from a paper by Geller from April 2011. I was only given the appendix so I am not sure but I assume the paper is called "High Throughput Indexed Library Preparation and Pooled Agilent Exome Enrichment" It has the sequences of the PCR primers as well as the adapter sequences. We use them here and they work very well.

That being said-can I say that they re exactly what is in the Illumina primer cocktail-no, but they work for us and we are a core facility so we make many libraries.
Those are the same primers (P5 and P7) that I tried (albeit with Phusion polymerase). Do you use the same reagents (Herculase II polymerase) and thermocycler protocol as they indicate in the Geller protocol?
seangallaher is offline   Reply With Quote
Old 11-26-2012, 07:11 AM   #8
kwaraska
Senior Member
 
Location: Boston,MA

Join Date: Nov 2008
Posts: 122
Default

No-we use the Kapa Master Mix. We found it better for GC rich templates so it became our standard.
kwaraska is offline   Reply With Quote
Old 11-26-2012, 09:13 AM   #9
luc
Senior Member
 
Location: US

Join Date: Dec 2010
Posts: 438
Default

We also use the Kapa-Hifi mastermix, an annealing temperature of 62 degrees, and PCR primers as detailed in:
http://genomics.med.tufts.edu/docume...q_Adapters.pdf

Actually, our PCR-Primer1 is two bases shorter and ends with "...TACAC".

For phusion, the recomended annealing temperature is 65 degrees, but this enzyme introduces strong GC biases.

http://www.biotechniques.com/Biotech...es-326018.html





Quote:
Originally Posted by kwaraska View Post
No-we use the Kapa Master Mix. We found it better for GC rich templates so it became our standard.
luc is offline   Reply With Quote
Old 11-26-2012, 03:40 PM   #10
seangallaher
Junior Member
 
Location: CA

Join Date: Sep 2011
Posts: 5
Default

Quote:
Originally Posted by luc View Post
We also use the Kapa-Hifi mastermix, an annealing temperature of 62 degrees, and PCR primers as detailed in:
http://genomics.med.tufts.edu/docume...q_Adapters.pdf

Actually, our PCR-Primer1 is two bases shorter and ends with "...TACAC".

For phusion, the recomended annealing temperature is 65 degrees, but this enzyme introduces strong GC biases.

http://www.biotechniques.com/Biotech...es-326018.html
Thanks for the info, but I'm confused. If I am not mistaken, the last 3 nt of PCR primer 2.0 in the Tufts protocol overlap with the index. Have you used that primer with indexed libraries? If I'm right, those primers would change the index so that 1/2 of it is the same in every library?
seangallaher is offline   Reply With Quote
Old 11-26-2012, 05:13 PM   #11
luc
Senior Member
 
Location: US

Join Date: Dec 2010
Posts: 438
Default

Hi Sean,
PCR primer 1 is homologous to the 5'end of the universal adapter in the Tufts protocol.
PCR primer 2 is homologous to the inverse complement of the barcoded adapter - to the 3'end as it is displayed in the protocol on page 3. It does not overlap with the barcode.

Quote:
Originally Posted by seangallaher View Post
Thanks for the info, but I'm confused. If I am not mistaken, the last 3 nt of PCR primer 2.0 in the Tufts protocol overlap with the index. Have you used that primer with indexed libraries? If I'm right, those primers would change the index so that 1/2 of it is the same in every library?
luc is offline   Reply With Quote
Old 11-27-2012, 10:10 AM   #12
seangallaher
Junior Member
 
Location: CA

Join Date: Sep 2011
Posts: 5
Default

Quote:
Originally Posted by luc View Post
Hi Sean,
PCR primer 1 is homologous to the 5'end of the universal adapter in the Tufts protocol.
PCR primer 2 is homologous to the inverse complement of the barcoded adapter - to the 3'end as it is displayed in the protocol on page 3. It does not overlap with the barcode.
I mapped it out again, and you are absolutely correct.

One more question: Why did you shorten PCR-primer1? To favorably alter the melting temperature? Did you try it both with and without the extra two nucleotides?

Thanks so much for your help!
seangallaher is offline   Reply With Quote
Old 11-27-2012, 10:45 AM   #13
luc
Senior Member
 
Location: US

Join Date: Dec 2010
Posts: 438
Default

Hi Sean,

there was no specific reason for the shorter primer. We got the sequences like this from another lab.
luc is offline   Reply With Quote
Old 11-28-2012, 01:42 AM   #14
JamieHeather
@jamimmunology
 
Location: London

Join Date: Nov 2012
Posts: 96
Default

I've not compared the sequences, but I use a 3' shortened version of P5 when I'm amplifying my libraries, just to bring the Tm in line with P7.
JamieHeather is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:40 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO