Go Back   SEQanswers > Applications Forums > Genomic Resequencing

Similar Threads
Thread Thread Starter Forum Replies Last Post
Pipeline for obtaining phased haplotype sequences w/out references mharve9 Bioinformatics 3 06-07-2015 11:34 PM
FreeBayes not standard haplotype calling francicco Bioinformatics 0 03-30-2015 09:40 AM
Haplotype caller 3.2 versions not calling a true variant Grebmot Genomic Resequencing 0 08-25-2014 02:08 PM
UnifiedGenotyper vs. Varscan vs. FreeBayes for Bacterial spp. Variant Calling Magas8282 Bioinformatics 1 05-22-2013 01:09 PM
Calling variants in a group of samples sharing a haplotype? Alex Coventry Bioinformatics 0 08-16-2011 11:39 AM

Thread Tools
Old 03-22-2016, 04:51 AM   #1
Location: Raleigh, NC

Join Date: Nov 2008
Posts: 48
Default freebayes haplotype calling (phased variants)

Hi All

I often use freebayes for variant calling and am pleased with the results. Now I want to use it to call haplotypes. The nature of my project is that I wish to phase variants in 400-450bp amplicons. These amplicons are generated from a mixed target source such that different targets within it will generate amplicons of slightly different sequence though different targets may share one or more specific variants. My plan was to subject these amplicons to 2X300 bp Illumina sequencing, merge read 1 and read 2, then align to a reference. The freebayes documentation indicates that the “-E” flag is required to call phased variants, and so I’ve included “-E 400” in my command line. I then tested this against simulated reads I made that contain a 2bp and 3bp deletion 11bp apart. While both deletions are called by freebayes I see nothing that indicates they are phased. I had read online that I might expect these two variants to be depicted by freebayes as a single "complex" variant bound by the 2 deletions. I do not. Moreover, in the header I see the following: "##phasing=none". Am I mistaken about how freebayes reports phased variants or is there something more to the proper command line that I am missing?




freebayes version: v1.0.2-14-g9e98366

$ freebayes -F 0.1 -E 400 -f target.ref.fa -v  out.ref.sort.bam

#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT  unknown
target  186     .       TAGAGGCTGCGTACGGGTAACACGTCGTAAGGAGCGATGACGCGGGCACTGCTCCGGCGTCGTCGA	TAGAGGCTGCGTACGGGTAACACGTCGTAAGGAGCGATGACGCGGGCACTGCTCCGGCGTCGTA      2403.38 .       AB=0;ABP=0;AC=2;AF=1;AN=2;AO=280;CIGAR=63M2D1M;DP=993;DPB=962.909;DPRA=0;EPP=4.53033;EPPR=0;GTI=0;LEN=2;MEANALT=452;MQM=17;MQMR=0;NS=1;NUMALT=1;ODDS=388.578;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=4320;QR=0;RO=0;RPL=280;RPP=611.023;RPPR=0;RPR=0;RUN=1;SAF=147;SAP=4.53033;SAR=133;SRF=0;SRP=0;SRR=0;TYPE=del     GT:DP:DPR:RO:QR:AO:QA:GL        1/1:993:993,280:0:0:280:4320:-327.573,-84.2884,0
target  261     .       TGAGGTGGAGGCGA  TGAGGTGGAGA     7515.8  .       AB=0;ABP=0;AC=2;AF=1;AN=2;AO=787;CIGAR=1M3D10M;DP=981;DPB=775.071;DPRA=0;EPP=5.02174;EPPR=0;GTI=0;LEN=3;MEANALT=37;MQM=17;MQMR=0;NS=1;NUMALT=1;ODDS=1091.43;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=13337;QR=0;RO=0;RPL=787;RPP=1711.96;RPPR=0;RPR=0;RUN=1;SAF=380;SAP=5.02174;SAR=407;SRF=0;SRP=0;SRR=0;TYPE=del     GT:DP:DPR:RO:QR:AO:QA:GL      1/1:981:981,787:0:0:787:13337:-991.985,-236.911,0

Last edited by GenoMax; 03-22-2016 at 05:06 AM. Reason: added CODE tags to improve readability
Mark is offline   Reply With Quote
Old 03-23-2016, 03:31 AM   #2
Senior Member
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,660

For reference cross-posted:
GenoMax is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 01:21 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO