SEQanswers

Go Back   SEQanswers > Applications Forums > Genomic Resequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Influence of quality of genome assembly for RNA-seq read mapping Julien Roux RNA Sequencing 0 01-28-2015 07:49 AM
BWA alignment of multiple read files, the order of processing matters? gene_x Bioinformatics 8 07-12-2013 01:20 PM
Problem with BWA mapping second read pbluescript Bioinformatics 3 10-12-2011 08:52 AM
BWA behaviour with Mate Pair data + Multi read mapping apratap Bioinformatics 5 06-23-2011 05:38 PM
BWA and Velvet : Anamolies in contigs and read mapping to reference apratap Bioinformatics 1 01-29-2010 01:44 PM

Reply
 
Thread Tools
Old 03-01-2016, 07:53 PM   #1
jfeicheng
Junior Member
 
Location: shanghai

Join Date: Feb 2014
Posts: 2
Default does read order influence bwa mapping?

I'm doing alignment with bwa (0.7.5a-r405).
But I found that the same sequence in different position may influence the mapping result.

As you may noticed, the read1 and read3 are exactly the same, but the mapping result is different.

read1 0 Chr3 209 0 50M * 0 0 CAAAGGTGCGGCCCGAGGTAAAGGGTTTAACGCTTCATATTTTATCACAT HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH XT:A:R NM:i:0 X0:i:2 X1:i:1 XM:i:0 XO:i:0 XG:i:0 MD:Z:50 XA:Z:Chr11,-26081473,50M,1;
read2 0 Chr3 208 0 50M * 0 0 ACAAAGGTGCGGCCCGAGGTAAAGGGTTTAACGCTTCATATTTTATCACA HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH XT:A:R NM:i:0 X0:i:2 X1:i:1 XM:i:0 XO:i:0 XG:i:0 MD:Z:50 XA:Z:Chr3,+4840,50M,0;Chr11,-26081474,50M,1;
read3 4 * 0 0 * * 0 0 CAAAGGTGCGGCCCGAGGTAAAGGGTTTAACGCTTCATATTTTATCACAT HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH

Does anyone know what's happening here?

the command line:
input=$1
bwa aln genome.fa $input >${input/.fq/}.sai
bwa samse -f ${input/.fq/}.sam genome.fa ${input/.fq/}.sai $input

Last edited by jfeicheng; 03-01-2016 at 08:07 PM.
jfeicheng is offline   Reply With Quote
Old 03-02-2016, 01:02 AM   #2
dariober
Senior Member
 
Location: Cambridge, UK

Join Date: May 2010
Posts: 310
Default

The mapping quality is 0 meaning that there are multiple and equally probable alignments. In this case bwa picks one location at random and this could explain why different reads with the same sequence are reported at different positions.
dariober is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:24 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO