Hi all!
I keep getting an error using the fastx_reverse_complement tool saying that I have an invalid quality score in one of my sequences in fastq format. The Error is:
fastx_reverse_complement: Error: invalid quality score data on line 281780 (quality_tok = "@M02529:176:000000000-AKLWJ:1:2113:11418:25147 1:N:0:3"
So I look up the line in the input file and it looks like this:
I simply can not find where the error should be in the last quality line (phred 33 quality score).
The input command is:
fastx_reverse_complement -Q33 -i input_file.fastq -o output_file.fastq
Can some of you just by looking at the quality score listed above see if something is wrong? Or is there something else in the sequence which is wrong?
Thank you very much in advance!
I keep getting an error using the fastx_reverse_complement tool saying that I have an invalid quality score in one of my sequences in fastq format. The Error is:
fastx_reverse_complement: Error: invalid quality score data on line 281780 (quality_tok = "@M02529:176:000000000-AKLWJ:1:2113:11418:25147 1:N:0:3"
So I look up the line in the input file and it looks like this:
Code:
@M02529:176:000000000-AKLWJ:1:2113:11418:25147 1:N:0:3 GATCTCCGGACTACTGGGGTTTCTAATCCTGTTTGCTCCCCTTGCTCTCGCGCCTCAGCGTCAGGTGTTAACTAGAAAACCGCTTTCGCCACAGGTGTTCTTCCACATATCTACGCATTTCACCGCTACACGTGGAATTCCGTTTTCTCCGTCAATCCTCTAGAATTGTAGTTTCAAATGCAGCTCCGAAGTTGAGCTTCGGAATTTCACATCTGACTTACAGTTCCGCCTACGCGCCCTTTACGCCCAATAATTCCGATTAATGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACACATCT + 8@BCC<@6+,@FFGGGCFGEGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGIIIIIIIIIIIIIIIIGIIIIIIGIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIEIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFIIFGIIGIIIIIIIIIIIIIGIIIIIIIIIIIIIIIIGGGGECGGGFGGGGGGGGGGGGGF7EGGGGGGGGGGGGGGGGFFFGGGGGCCCCC
The input command is:
fastx_reverse_complement -Q33 -i input_file.fastq -o output_file.fastq
Can some of you just by looking at the quality score listed above see if something is wrong? Or is there something else in the sequence which is wrong?
Thank you very much in advance!
Comment