SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
PhiX control for a custom made library ymym Illumina/Solexa 1 03-20-2017 04:05 AM
featureCount with custom GTF file haritz_irizar RNA Sequencing 2 03-02-2016 10:14 AM
Trimmomatic Keeps All Reads But Outputs An Empty File Dario1984 Bioinformatics 1 09-12-2014 05:08 AM
CuffDiff cannot opn BAM file made in TopHat gwilymh Bioinformatics 2 09-12-2013 04:04 AM
samtools/bcftools: How to inspect SNPs not made it into vcf file muenalan Bioinformatics 2 09-06-2012 06:13 AM

Reply
 
Thread Tools
Old 05-03-2017, 01:29 AM   #1
candida
Junior Member
 
Location: Singapore

Join Date: Oct 2010
Posts: 2
Default Trimmomatic adapter file vs Custom made file

Hello everyone,


I am working with TruSeq paired end data (150bp). I have a doubt regarding the adapter file provided in Trimmomatic for trimming adapters.

According to the Trimmomatic provided adapter file "TruSeq3-PE-2.fa" the reverse complement of index adapter sequence is used for trimming reads from R2 file and the universal adapter is used for trimming reads from R1 file.
>PrefixPE/1 TACACTCTTTCCCTACACGACGCTCTTCCGATCT

>PrefixPE/2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

>PE1 TACACTCTTTCCCTACACGACGCTCTTCCGATCT

>PE1_rc AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA

>PE2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

>PE2_rc AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

However, it looks like that for my data the actual sequences of the index adapter is in the R1 file and the reverse complement of the universal adapter is in the R2 file.

This information was also provided to me by Illumina support team.
https://support.illumina.com/bulleti...-trimming.html

Therefore I prepared my adapter file as follows (I'm using the full sequence):
>PrefixPE/1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG (index adapter)

>PrefixPE/2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT ( reverse complement of universal adapter)

>PE1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

>PE1_rc CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (revcomp of PE1)

>PE2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

>PE2_rc AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (revcomp of PE2)

Please let me know if this adapter file I prepared is fine or is the Trimmomatic adapter file better and needs to be used always.
I tried my custom made file as well as the Trimmomatic recommended file and found that both removed adapters when checked using FASTQC!!

Please correct me or let me know if I'm missing something!
Appreciate your help and guidance!
Thanks,
Candida
candida is offline   Reply With Quote
Old 05-03-2017, 04:07 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,800
Default

For reference cross posted: https://www.biostars.org/p/250425
GenoMax is offline   Reply With Quote
Reply

Tags
adapter, illumina, paired-end, rnaseq, trimmomatic

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:39 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO