
Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa

Similar Threads
Thread Thread Starter Forum Replies Last Post
How to mask and not remove "adapter" sequence? GeGnome Bioinformatics 3 09-09-2015 06:41 AM
MiSeq bright spots in "C" images only. pmiguel Illumina/Solexa 12 06-14-2015 01:38 AM
MiSeq calls "A" > 95% of the time timothylaurent Illumina/Solexa 1 04-10-2012 10:02 AM
The position file formats ".clocs" and "_pos.txt"? Ist there any difference? elgor Illumina/Solexa 0 06-27-2011 08:55 AM
"Systems biology and administration" & "Genome generation: no engineering allowed" seb567 Bioinformatics 0 05-25-2010 01:19 PM

Thread Tools
Old 09-11-2012, 10:24 AM   #1
--Site Admin--
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,355
Default Do not use "adapter trimming" in MiSeq Reporter 2.0.25

We've identified what appears to be a severe bug in adapter trimming in the newest version of MSR (2.0.25). The sample sheet (generated by Experiment manager 1.3, by default) specifies an adapter sequence to trim from the FASTQs.

The sequence that is specified is only 20bp of one side ( ) of the TruSeq adapter..."AGATCGGAAGAGCACACGTC"...but the trimming is so promiscuous that reads from several regions of the genome (that I've found so far) are getting trimmed at the genomic location. I haven't had time to further characterize the effect, but I've just shut off adapter trimming as it seems like it was developed and tested against a less complex genome than human *cough*phiX*cough*.

We first noticed the problem in CFTR exon 10, see the phenotype in the IGV screenshot below, where the same run was put through MSReporter with and without adapter trimming. I'll let you guess which is which. Note that only the R1's are trimmed...R2s from the same cluster aren't (because only one side of the TruSeq adapter is specified).

Another example in another gene:

...zoomed in to see the sequence:

Looking at the directionality of trimming and manually aligning the genomic location to the MSR trimming sequence, it seems immediately evident what's going on...and that it is indeed promiscuous adapter trimming...that somehow is trimming when there is 5-6 mismatches over 20bp.

Anyway, just thought I'd share...make sure to turn that off. And trust no one with trimming.
ECO is offline   Reply With Quote
Old 09-17-2012, 04:20 PM   #2
Senior Member
Location: Monash University, Melbourne, Australia.

Join Date: Jan 2008
Posts: 246

FYI: According to Illumina, the MiSeq used ELAND prior to V2 of MSR, and now uses BWA to do the adapter trimming/masking.
ScottC is offline   Reply With Quote
Old 09-19-2012, 01:35 PM   #3
Junior Member
Location: San Diego

Join Date: Sep 2012
Posts: 5
Default MiSeq Reporter (MSR) current version is 2.0.26

Please note that the MSR v2.0.25 is no longer current and MSR v2.0.26 should be installed.

MSR v2.0.26 addresses various software bugs.

Contact your local Illumina FAS or call Illumina Technical Support 858-202-4500 to schedule the software upgrade on your MiSeq system.

an Illumina Customer Support Representative
garyb is offline   Reply With Quote
Old 09-25-2012, 07:38 AM   #4
Senior Member
Location: Halifax, Nova Scotia

Join Date: Mar 2009
Posts: 381

Thanks for this. We have the latest MiSeq software update and promiscuous trimming is rampant. Now just have to figure how to re-call fastqs without trimming from the raw data
JackieBadger is offline   Reply With Quote
Old 09-25-2012, 08:15 AM   #5
Junior Member
Location: San Diego

Join Date: Sep 2012
Posts: 5

Originally Posted by JackieBadger View Post
Thanks for this. We have the latest MiSeq software update and promiscuous trimming is rampant. Now just have to figure how to re-call fastqs without trimming from the raw data
The Sample Sheet in the MiSeq Analysis run folder can be dynamically edited before an MSR re-queue analysis and the following changes made:

Delete the Adapter line in the Settings section of the sample sheet.
Add the OnlyGenerateFASTQ 1 in the Settings section of the sample sheet.

Save the sample sheet - keep the default name. Re-queue the run in MSR. Only FASTQs will be regenerated without any secondary analysis or trimming.

Illumina Customer Solutions representative
garyb is offline   Reply With Quote
Old 09-25-2012, 10:09 AM   #6
--Site Admin--
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,355

Originally Posted by garyb View Post
Please note that the MSR v2.0.25 is no longer current and MSR v2.0.26 should be installed.

MSR v2.0.26 addresses various software bugs.

Contact your local Illumina FAS or call Illumina Technical Support 858-202-4500 to schedule the software upgrade on your MiSeq system.

an Illumina Customer Support Representative
2.0.26 doesn't change the adapter trimming, right?
ECO is offline   Reply With Quote
Old 09-25-2012, 04:59 PM   #7
Junior Member
Location: San Diego

Join Date: Sep 2012
Posts: 5

A software update to MSR software due in October 2012 will address the adapter trimming issue.

It is best to avoid adapter trimming until then by deletion of the Settings Adapter line in the sample sheet.

Most users should by now be using the MSR 1.3.16 or higher version. This version in fact generates FASTQs alone as a separate workflow. Use the following sample sheet entries to regenerate the FASTQs:

Workflow GenerateFASTQ
Application FASTQ Only

Make those changes to the sample sheet and requeue for MSR analysis and you should see a full new set of FASTQs without further secondary processing. Typical FASTQ generation time takes approximately 15 minutes or less.

an Illumina Customer Support representative
garyb is offline   Reply With Quote
Old 09-25-2012, 06:30 PM   #8
--Site Admin--
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,355

Thanks garyb!
ECO is offline   Reply With Quote
Old 12-10-2013, 03:58 AM   #9
Location: Lisbon, Portugal

Join Date: Jan 2012
Posts: 21
Default How's the adapter trimming in most recent versions of MSR?

Just wandering if the reported "rampant" behavior is under control now.

dsobral is offline   Reply With Quote
Old 12-10-2013, 05:38 AM   #10
Senior Member
Location: Halifax, Nova Scotia

Join Date: Mar 2009
Posts: 381

I still wouldn't use it. Illumina stated they had fixed it in one of their upgrades but hadn't. Maybe it is fixed now? I much prefer to look at the data myself and process it so I know exactly what has been done to it
JackieBadger is offline   Reply With Quote

adapter, miseq, trim

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 08:01 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO