SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
adapter not detected silvi Bioinformatics 0 06-21-2013 02:15 AM
Adapter searching seq_GA Bioinformatics 3 07-18-2011 01:48 AM
titrate adapter and others xenia.zhang Illumina/Solexa 0 01-13-2010 08:04 AM
adapter multimers misscleo Illumina/Solexa 5 07-25-2009 10:48 AM
3' Adapter Trimming caddymob Bioinformatics 0 05-27-2009 01:53 PM

Reply
 
Thread Tools
Old 11-15-2013, 03:48 AM   #1
yueli
Member
 
Location: china

Join Date: May 2013
Posts: 53
Default adapter

Hi,

I have a file just as follow:

3' Adapter



5'

-------------------- -------------------- --------- (-)

AMPCTGTAGGCACCATCAATdideoxyC---------- 3'



3'

-------------------- -------------------- --------- (-) --------------------

----------------- 5'



5' Adapter



5'

-------------------- ---GUUCAGAGUUCUACAGU CCGACGAUC (-)

-------------------------------------- 3'



3'

-------------------- -------------------- --------- (-) --------------------

----------------- 5'

I just want to know what is the adapter. The 3' adapter I think is AMPCTGTAGGCACCATCAATdideoxyC, but how about the 5' adaper?

Is it GUUCAGAGUUCUACAGU or CCGACGAUC or just combine them GUUCAGAGUUCUACAGUCCGACGAUC? I got confusing.

Thanks,
yueli is offline   Reply With Quote
Reply

Tags
adapter

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:53 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO