SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
RRDS adapter mismatch design huwenhuo Epigenetics 0 04-18-2014 01:55 PM
Designing P1 P2 adapters for RAD-seq flobpf Sample Prep / Library Generation 0 01-29-2014 06:25 AM
Can I pool different species for RAD seq? sw8362 Sample Prep / Library Generation 4 01-27-2014 07:42 PM
Primer and adapter design for small RNA sequencing in HiSeq2000 and MiSeq windhorse8 Illumina/Solexa 3 10-09-2013 07:39 AM
Adapter primer design issues, and why phosphorothioate bonds? LAGroh Sample Prep / Library Generation 2 09-27-2013 12:42 AM

Reply
 
Thread Tools
Old 05-27-2014, 10:46 AM   #1
flobpf
Member
 
Location: USA

Join Date: Apr 2010
Posts: 76
Default RAD-seq adapter design

Hi

I was planning a RAD-seq experiment for about 90 ecotypes. The costs of ordering 180+ HPLC purified and modified oligos for those many samples are quite prohibitive. Hence, I was thinking of a double-index strategy for pooling all my samples using Illumina, and I wonder if someone could provide some feedback on whether the following oligo design would be appropriate for Illumina and RAD-seq.

So essentially, the P1 adapter would be

Code:
Read 1 sequencing primer -- Barcode -- REoverhang

ACACTCTTTCCCTACACGACGCTCTTCCGATCT -- AACTA -- CAT*G
The P2 adapter would be

Code:
Read 2 sequencing primer -- IlluminaIndex -- P7 attachment site
so that the final DNA would look like:

Quote:
Read 1 sequencing primer -- Barcode -- REoverhang --DNA of interest --Read 2 sequencing primer -- IlluminaIndex -- P7 attachment site
I would also have to order two primer oligos for PCR amplification:
Code:
P5 attachment site -- Read1 SeqPrimer --> 1 primer
P7 attachment site -- IlluminaIndex -- Read2 SeqPrimer --> 10 primers
based on the information provided here

Thus, if I do Paired End sequencing, then for 90 ecotypes, I calculated that I would just need to order
Quote:
P1: 10*2 = 20 (*2 to make double strand)
P2: 10*2 = 20
PCR primers: 11
Total=51
instead of ~200 odd oligos for the regular RAD-seq protocol, leading to significant cost savings. One drawback is that I won't be able to pool the samples after attaching the P1 adapter; instead I can only pool in sets of 10. However, given the cost savings, I think that is ok.

Does this strategy sound feasible?

Last edited by flobpf; 06-02-2014 at 10:08 AM.
flobpf is offline   Reply With Quote
Reply

Tags
adapter, rad sequencing, rad-seq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:03 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO