Extract Seq from Primers on BBDuK

m.a.celik · 01-31-2019, 03:28 AM

Hello guys, a newbie in here.

I have reads from nanopore, converted fast5 files into fastq, what i am trying to do is extract the sequences between the primers. I attempt to do it by bbduk from BBMap.

First I tried this

Code:

./bbduk.sh in=/home/celik/Downloads/deneme/2/first0.fastq out=/home/dnacoder/Downloads/deneme/2/cikis.fasta literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA

which gave me an error saying "Error: Could not find or load main class jgi.BBDukF"

Then I searched and tried this running this code

Code:

java -ea -Xmx1g -cp /home/celik/Downloads/BBMAP/BBMap-master/sh/current/jgi.BBDuKF in=first0.fastq out=cikis.fastq literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA

then it gave me an error that read "Could not find or load main class in=first0.fastq"

Can anyone tell me what am I doing wrong, i ve looked on google and tried couple of things such as "export CLASSPATH=$CLASSPATH:." but did not make any change.

Thanks in advance.

GenoMax · 01-31-2019, 05:34 AM

Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?

m.a.celik · 01-31-2019, 05:40 AM

Quote:

Originally Posted by GenoMax

Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?

Nope, I am on biolinux(Ubuntu), and no I ve just extracted the zip file, didn't move anything. Thanks for a quick respond.

m.a.celik · 05-16-2019, 07:39 AM

Guys anyone can help me? I am still struggling with this.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
BBduk for NexteraXT	arivers	Bioinformatics	3	05-07-2018 10:52 AM
Extract 'amplicon' based on custom primers	SDH	Bioinformatics	3	05-07-2018 08:57 AM
BBDUK and BBMERGE, which goes first	chloe1005	Bioinformatics	1	04-12-2018 03:43 AM
bbduk.sh barcode filter	lamon	Bioinformatics	8	11-18-2017 03:51 AM
Trimmomatic vs bbduk.sh	mslider	Bioinformatics	1	04-18-2017 10:10 AM

01-31-2019, 03:28 AM	#1
m.a.celik Junior Member Location: Turkey Join Date: Jan 2019 Posts: 3	Extract Seq from Primers on BBDuK Hello guys, a newbie in here. I have reads from nanopore, converted fast5 files into fastq, what i am trying to do is extract the sequences between the primers. I attempt to do it by bbduk from BBMap. First I tried this Code: ./bbduk.sh in=/home/celik/Downloads/deneme/2/first0.fastq out=/home/dnacoder/Downloads/deneme/2/cikis.fasta literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA which gave me an error saying "Error: Could not find or load main class jgi.BBDukF" Then I searched and tried this running this code Code: java -ea -Xmx1g -cp /home/celik/Downloads/BBMAP/BBMap-master/sh/current/jgi.BBDuKF in=first0.fastq out=cikis.fastq literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA then it gave me an error that read "Could not find or load main class in=first0.fastq" Can anyone tell me what am I doing wrong, i ve looked on google and tried couple of things such as "export CLASSPATH=$CLASSPATH:." but did not make any change. Thanks in advance.

01-31-2019, 05:34 AM	#2
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 7,092	Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?

05-16-2019, 07:39 AM	#4
m.a.celik Junior Member Location: Turkey Join Date: Jan 2019 Posts: 3	Guys anyone can help me? I am still struggling with this.