
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Chromosome start and end coordinates Ooinp Bioinformatics 1 04-23-2012 10:13 AM
Parsing a Chromosome sequence with start and end coordinates empyrean Bioinformatics 13 09-10-2011 09:23 PM

Thread Tools
Old 03-07-2018, 05:35 AM   #1
Junior Member
Location: Berlin

Join Date: Sep 2017
Posts: 4
Default Retrieve genomic coordinates (locus start, locus end) from blastn hits?

Hi everyone, I'm trying to carry out some sort of reciprocal best hits analysis with blastn (so two-step process) in order to find orthologs (I know it is probably not the best way) of novel human miRNAs predicted by a software called miRDeep2. Working on linux and using blast 2.2.30+ version. I'm basically using blastn against the pre-formatted ncbi database of partially non-redundant nucleotides (the huge one, I downloaded from here*), but limiting the search by using -seqidlist with a file containing all accession numbers for all mammalian-human genes, contigs, chunks or DNA or whatever is in the databases. This accession list for mammals I got it by doing this:

"esearch -db nucleotide -query "Mammalia[organism]" | efetch -db nucleotide -format acc > mammalia.acc"

Then I did the same for homo sapiens, and I also subtracted both in order to have an accession list with mammals excluding humans;

"esearch -db nucleotide -query "Homo sapiens[organism]" | efetch -db nucleotide -format acc > hsa.acc"

The command line for running blastn looks something like this (the miRNA fasta files only contain one sequence plus an identifier per file, and the sequences are short, between 50 and 90 nt, the mammalian acc file has around 35M lines):

blastn -db nt -seqidlist mammalian_minus_hsa.acc -query mymiRNA.fa -out mymiRNA_blast.out -evalue 1e-10 -word_size 20 -outfmt "6 qacc sseqid sseq sstart send sscinames evalue"

In the end I get some hits against each of my novel miRNAs, and these hits of course have an ID, and it also tells you the start and end position of the match both in your query and in the subject sequence. But this is not what I need, now I would like to have the specific genomic locations of the matches for each subject sequences (locus start and locus end of the hit) in order to know where these sequences are located in mammals. I was thinking maybe I could get the genomic coordinates for the accession number of each hit, and then I would just need to add or subtract these positions to the start and end positions of the matches in my sequences...but I still haven't found a way of getting these genomic coordinates by using an ID, I would appreciate some suggestions...

I also need these locations because ultimately what I want to do is to take each of my novel human miRNAs, and for each best mammal hit I get (best one per organism), blast it back against the human genome, and check if the best hit I get now is located in the same position where I know my novel human miRNA is located, so that I can consider them orthologs, and for each of these novel miRNAs, have a fasta file with all its orthologs for further analysis.

I hope it is more or less clear what I intend to do.

Thank you in advance,
sombrajo is offline   Reply With Quote
Old 03-08-2018, 09:39 AM   #2
Location: Florida, US

Join Date: May 2017
Posts: 14

I am not 100% clear on what additional data you are trying to pull out from the blastn output.

Could you post a sample of the blastn output, and maybe a rough schematic of what you wish the them to look like after processing?
cstack is offline   Reply With Quote
Old 03-10-2018, 03:09 AM   #3
Junior Member
Location: Berlin

Join Date: Sep 2017
Posts: 4

This is an example of how my blastn output looked like:

8_124616757-124616839- gi|54908|emb|X04525.1| GCCTCCTTAGCGCAGTAGGTAGCGCGTCAGTCTCATAATCTGAAG 1 45 Mus musculus 3e-12
8_124616757-124616839- gi|51571999|gb|AC119854.7| GCCTCCTTAGCGCAGTAGGCAGCGCGTCAGTCTCATAATCTGAAGAT 74096 74142 Mus musculus 1e-11
8_124616757-124616839- gi|37651859|gb|AC101490.8| GCCTCCTTAGCGCAGTAGGCAGCGCGTCAGTCTCATAATCTGAAGAT 223791 223837 Mus musculus 1e-11

As I understand this, each row corresponds to a hit, so a match was found for each of the accessions that are shown, then it shows the exact match in terms of DNA sequence, followed by the start and end position of the match within the piece of DNA represented by this accession number, the problem being that I took all accession numbers of all mammals in the nucleotide database to blast against, so those accessions may correspond to genes, contigs or whole chromosomes submitted to the NCBI database, and sometimes there is no information about the genomic location of these sequences. I just wanted to know, for each hit, where exactly in the mammal genome it belongs in terms of genomic coordinates, but I don't think that blast keeps track of this information so there is no direct way of getting what I want from the blast output. Anyways, I ended up retrieving whatever information was available for each hit by means of its accession (esearch | efetch), and since some of them, as I said, don't contain information about chromosomic location, I just gave up on that.

Last edited by sombrajo; 03-10-2018 at 03:14 AM.
sombrajo is offline   Reply With Quote

blast, coordinates, reciprocal blast hits

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 03:51 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO