SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie Seed length (-l) and non-unique reads mode (m=-1) ericguo Bioinformatics 2 03-22-2012 06:54 AM
TopHat BowTie -n mode vinay052003 Bioinformatics 1 11-24-2011 09:03 AM
Bowtie -n and -v mode ZhengXia Bioinformatics 3 12-21-2010 01:19 AM
Soap2 paired end mode rahul.m.dhodapkar Bioinformatics 1 08-25-2010 08:18 AM
bowtie paired end mode boetsie Bioinformatics 1 08-18-2010 05:12 AM

Reply
 
Thread Tools
Old 07-02-2012, 07:38 AM   #1
wariobrega
Member
 
Location: Quadraro, Rome

Join Date: Jul 2012
Posts: 11
Default Bowtie 2 explanation of the pair-end mode report

Hello everybody. I'm a Master Student in Molecular Biology and Bioinformatics and pretty new to NGS technologies. I am using bowtie2 in pair-end mode after using bowtie1 in single end mode on some nanoCAGE RNA seq data. The reason I'm doing this is because bowtie1 in pair end mode has less customizable options than bowtie2 and is not possible to choose the size for the alignment window for the pair end mates, so I had very low alignment score against my reference genome (between 12 and 14% against my 90% and over in single end mode).

I cannot understand the report of the alignment score of Bowtie 2 in some parts. Here's an example:
Quote:
16182999 reads; of these:
16182999 (100.00%) were paired; of these:
5731231 (35.42%) aligned concordantly 0 times
4522376 (27.95%) aligned concordantly exactly 1 time
5929392 (36.64%) aligned concordantly >1 times
----
5731231 pairs aligned concordantly 0 times; of these:
2381431 (41.55%) aligned discordantly 1 time
----
3349800 pairs aligned 0 times concordantly or discordantly; of these:
6699600 mates make up the pairs; of these:
3814736 (56.94%) aligned 0 times
1883429 (28.11%) aligned exactly 1 time
1001435 (14.95%) aligned >1 times
88.21% overall alignment rate
I have run bowtie 2 in pair end mode using the
Code:
-fr
option for the orientation of my reads.

according to the bolded part of the report, i have a lot of reads take in PE (because it specifies 6699600 mates out of 3349800 pairs which aligns nor concordantly nor discordantly (so they are not aligned on the genome). But still a fraction of these mates aligns. How is that possible? They shouldn't align at all!

also, I do not understand the overall score; Is there a place in which I can look to the criteria of this score? How does that 88.21% comes from?

Thanks for any kind of answer that you can give to me!

Daniele
wariobrega is offline   Reply With Quote
Old 07-03-2012, 12:24 AM   #2
amitm
Member
 
Location: Manchester, UK

Join Date: Feb 2011
Posts: 52
Default

Quote:
Originally Posted by wariobrega View Post
I cannot understand the report of the alignment score of Bowtie 2 in some parts. Here's an example:
according to the bolded part of the report, i have a lot of reads take in PE (because it specifies 6699600 mates out of 3349800 pairs which aligns nor concordantly nor discordantly (so they are not aligned on the genome). But still a fraction of these mates aligns. How is that possible? They shouldn't align at all!

also, I do not understand the overall score; Is there a place in which I can look to the criteria of this score? How does that 88.21% comes from?

Thanks for any kind of answer that you can give to me!

Daniele
hi daniele,
the Bowtie2 result summary is divided in 3 sections:
  • Concordant alignment - In your data (4522376 + 5929392) reads align concordantly. Which is 64.59% of reads
  • Discordant alignment - So now 5731231 reads remain which is 35.41% (100-64.59). Of these, 2381431 reads align discordantly. That is to say, of the non-concordant fraction, 41.55% of reads (2381431 reads) align discordantly.
  • The rest - Now, remember that alignment whether concord. or discord., but both are aligned in paired-end mode. The rest of the reads either align as singles (i.e. Read1 in one locus & Read2 in completely different locus or one mate aligned and the other unaligned) or may not align at all. So the reads that are in this section is Total -(Concord.+Discord.). That is 16182999 -(10451768+2381431) = 3349800 reads.
    Since alignment, if any, here is in single fashion so we calculate in mates (readsx2).

Now to reach the overall alignment, count the mates in total (i.e. mates aligned in paired and mates aligned in single fashion). That would be -
(10451768 x2)+(2381431 x2)+1883429+1001435 = 28551262 mates
That is 28551262 mates aligned of total (16182999 x2) mates, which is 88.21%.
amitm is offline   Reply With Quote
Old 07-03-2012, 02:45 AM   #3
wariobrega
Member
 
Location: Quadraro, Rome

Join Date: Jul 2012
Posts: 11
Default

Quote:
Originally Posted by amitm View Post
hi daniele,
the Bowtie2 result summary is divided in 3 sections:
  • Concordant alignment - In your data (4522376 + 5929392) reads align concordantly. Which is 64.59% of reads
  • Discordant alignment - So now 5731231 reads remain which is 35.41% (100-64.59). Of these, 2381431 reads align discordantly. That is to say, of the non-concordant fraction, 41.55% of reads (2381431 reads) align discordantly.
  • The rest - Now, remember that alignment whether concord. or discord., but both are aligned in paired-end mode. The rest of the reads either align as singles (i.e. Read1 in one locus & Read2 in completely different locus or one mate aligned and the other unaligned) or may not align at all. So the reads that are in this section is Total -(Concord.+Discord.). That is 16182999 -(10451768+2381431) = 3349800 reads.
    Since alignment, if any, here is in single fashion so we calculate in mates (readsx2).

Now to reach the overall alignment, count the mates in total (i.e. mates aligned in paired and mates aligned in single fashion). That would be -
(10451768 x2)+(2381431 x2)+1883429+1001435 = 28551262 mates
That is 28551262 mates aligned of total (16182999 x2) mates, which is 88.21%.
Thanks a lot for the explanation. So Bowtie 2 DOES align the reads in SE that do not align concordantly or discordantly in PE mode. But why this further alignment should be consider useful if it the reads does not match the PE criteria? Won't they probably align in other non significant regions and maybe false the output score?

Thanks a lot, also for the explanation of the Out score
wariobrega is offline   Reply With Quote
Old 01-15-2013, 01:46 PM   #4
vittoria_1198
Junior Member
 
Location: Hawaii

Join Date: Jan 2013
Posts: 2
Default

Hi,
I am a very new user of bowtie. I used bowtie 2.0.0 to run a map step with single reads against a transcriptome reference.
At the end of the process, the alignment summary looed like this:

20000 reads; of these:
20000 (100.00%) were unpaired; of these:
1247 (6.24%) aligned 0 times
18739 (93.69%) aligned exactly 1 time
14 (0.07%) aligned >1 times
93.77% overall alignment rate

I am having hard time to understand the difference between the reads that align 1 time and the one that align more then 1 times. What does those last one mean? Should I considerate in my stats report only those theta align 1 time?
Moreover, I tried to take a look at the SAM file generated, and I could not be able to understand what is in it.
This is one line of the SAM file
@HD VN:1.0 SO:unsorted
@SQ SN:comp5504567_c0_seq1 LN:554

What are the meaning of each symbols?
Thanks so much for the help

Vittoria
vittoria_1198 is offline   Reply With Quote
Old 01-15-2013, 02:26 PM   #5
winsettz
Member
 
Location: US

Join Date: Sep 2012
Posts: 91
Default

Quote:
Originally Posted by vittoria_1198 View Post
Hi,
I am a very new user of bowtie. I used bowtie 2.0.0 to run a map step with single reads against a transcriptome reference.
At the end of the process, the alignment summary looed like this:

20000 reads; of these:
20000 (100.00%) were unpaired; of these:
1247 (6.24%) aligned 0 times
18739 (93.69%) aligned exactly 1 time
14 (0.07%) aligned >1 times
93.77% overall alignment rate

I am having hard time to understand the difference between the reads that align 1 time and the one that align more then 1 times. What does those last one mean? Should I considerate in my stats report only those theta align 1 time?
Moreover, I tried to take a look at the SAM file generated, and I could not be able to understand what is in it.
This is one line of the SAM file
@HD VN:1.0 SO:unsorted
@SQ SN:comp5504567_c0_seq1 LN:554

What are the meaning of each symbols?
Thanks so much for the help

Vittoria
It suggests that some reads can theoretically align to more than one part of your reference.

For the SAM specification:
http://samtools.sourceforge.net/SAM1.pdf

Quote:
Tag Description
@HD The header line. The rst line if present
VN* Format version. Accepted format: /^[0-9]+\.[0-9]+$/.
SO Sorting order of alignments. Valid values: unknown (default),unsorted, queryname andcoordinate.

@SQ Reference sequence dictionary. The order of @SQ lines de fines the alignment sorting order
SN* Reference sequence name. Each @SQ line must have a unique SN tag
LN* Reference sequence length
winsettz is offline   Reply With Quote
Old 08-07-2013, 02:05 AM   #6
jajclement
Junior Member
 
Location: Montpellier, France

Join Date: May 2012
Posts: 6
Default

Hi!
Thank you a lot to amitm for his detailed answer. I had the same interpretation problem and it is now clearer for me after reading his reply to wariobrega.

I need another precision about the terms "concordantly" and "discondordantly": what does it mean exactly?

Thank you to all answers

Last edited by jajclement; 08-07-2013 at 02:10 AM.
jajclement is offline   Reply With Quote
Old 08-07-2013, 04:58 AM   #7
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

Quote:
Originally Posted by jajclement View Post
Hi!
Thank you a lot to amitm for his detailed answer. I had the same interpretation problem and it is now clearer for me after reading his reply to wariobrega.

I need another precision about the terms "concordantly" and "discondordantly": what does it mean exactly?

Thank you to all answers
Did you read the bowtie2 manual page? It's explained there.
dpryan is offline   Reply With Quote
Old 08-07-2013, 05:09 AM   #8
jajclement
Junior Member
 
Location: Montpellier, France

Join Date: May 2012
Posts: 6
Default

Thank you a lot for your answer.
In fact I just found the answer to my question...and was unable to clear my request.
Just a lesson to keep in mind: RTFM!!!
jajclement is offline   Reply With Quote
Old 03-21-2017, 12:34 AM   #9
chin
Junior Member
 
Location: Malaysia

Join Date: Mar 2017
Posts: 1
Default

How about if there not 100% for aligned, such as:
112291170 reads; of these:
95730389 (85.25%) were paired; of these:
78503591 (82.00%) aligned concordantly 0 times
1638154 (1.71%) aligned concordantly exactly 1 time
15588644 (16.28%) aligned concordantly >1 times
----
78503591 pairs aligned concordantly 0 times; of these:
1695209 (2.16%) aligned discordantly 1 time
----
76808382 pairs aligned 0 times concordantly or discordantly; of these:
153616764 mates make up the pairs; of these:
98441019 (64.08%) aligned 0 times
17302306 (11.26%) aligned exactly 1 time
37873439 (24.65%) aligned >1 times
16560781 (14.75%) were unpaired; of these:
4655378 (28.11%) aligned 0 times
1290964 (7.80%) aligned exactly 1 time
10614439 (64.09%) aligned >1 times
50.44% overall alignment rate
How should I calculate its overall alignment rate?
Thank you.
chin is offline   Reply With Quote
Old 03-21-2017, 01:02 AM   #10
yksikaksi
Member
 
Location: Scandinavia

Join Date: Dec 2009
Posts: 20
Default

Quote:
Originally Posted by chin View Post
How about if there not 100% for aligned, such as:
112291170 reads; of these:
95730389 (85.25%) were paired; of these:
78503591 (82.00%) aligned concordantly 0 times
1638154 (1.71%) aligned concordantly exactly 1 time
15588644 (16.28%) aligned concordantly >1 times
----
78503591 pairs aligned concordantly 0 times; of these:
1695209 (2.16%) aligned discordantly 1 time
----
76808382 pairs aligned 0 times concordantly or discordantly; of these:
153616764 mates make up the pairs; of these:
98441019 (64.08%) aligned 0 times
17302306 (11.26%) aligned exactly 1 time
37873439 (24.65%) aligned >1 times
16560781 (14.75%) were unpaired; of these:
4655378 (28.11%) aligned 0 times
1290964 (7.80%) aligned exactly 1 time
10614439 (64.09%) aligned >1 times
50.44% overall alignment rate
How should I calculate its overall alignment rate?
Thank you.
Please give more information about the data above. A brief summary of your method and work will be hlepful for those who might able to help.
yksikaksi is offline   Reply With Quote
Old 07-15-2018, 02:52 AM   #11
shauryajauhari
Junior Member
 
Location: India

Join Date: Aug 2017
Posts: 2
Default

Using bowtie2, an alignment file (SAM) file was inferred. The question at hand is to report the count and sequences of multiple mapped reads.
As per the flags and tags specifications of the SAM format, I am trying to sift the alignment file on the basis of the following:
1. The value of N in each record carrying tags XS:i:<N> and AS:i:<N> must be identical.
2. The reads are preconditioned to be concordantly aligned, i.e. "YT:Z:CP" tag is set.
3. The flags 0x100 (256 bits) and 0x800 (2048 bits) represent secondary and supplementary mappings respectively.
Despite the aforementioned stipulations, the output is discrepant as compared to the alignment summary provided by bowtie2. Is there any alternative to the logic as stated.
Thanks in advance.
SJ.
shauryajauhari is offline   Reply With Quote
Old 07-15-2018, 02:57 AM   #12
shauryajauhari
Junior Member
 
Location: India

Join Date: Aug 2017
Posts: 2
Default How to derive multiple mapped reads from a SAM file?

MAPQ score of 255 engenders uniquely aligned reads; not to mention with the highest mapping score. Based on some literature, and by logic too, isn't it obvious that any number between 0 and 255 will represent multiple aligned reads. So, is it a subjective matter to chose quality score (depiction as per the 5th field in the SAM file) to ascertain multiple reads.
I believe the following will simply do the trick:
> samtools view -b -q <quality score> your_alignment_file.bam > filtered.bam
Additionally, could you also comment on the discrepancy (if any) with the alignment summary/ statistics from Bowtie2.
shauryajauhari is offline   Reply With Quote
Old 07-18-2018, 11:57 PM   #13
gopal_botany
Junior Member
 
Location: New Delhi India

Join Date: Jan 2014
Posts: 3
Default

Hello Everyone,

I have 2x250 paired-end data of bacteria, I have aligned reads to reference by bowtie2 and got the sam file output.

My query is, how to get the mapping position of read2 (mate read) as in sam alignment the mapping position remain same, See few lines of alignment

M01976:19:000000000-D240E:1:1101:14558:1508 73 16CFP21_Rv1984c 449 3 110M = 449 0 GTGGTTTCTCCAGCATGTTGTGGGTCGGCTTTTCGTTTCCGACAATCGTTCCGCTGTTTATCTCTAAGTCCATTAACTTGTGTGCT
CCCGACGTTCCATTTTGCACCGTT AFB0FFGEFAA1100B1DA2B////0/////012/>>/12/////B1//>00//>/?11212>>B2122211B2211>B1B1B01B11//////?0011?1?11110/0. AS:i:-45 XN:i:0 XM:i:15 XO:i:0 XG:i:0 NM:i:15 MD:Z:2
4G4G0G0G5G10G8A2G7A4A19A4A1A7G0A0 YT:Z:UP
M01976:19:000000000-D240E:1:1101:14558:1508 133 16CFP21_Rv1984c 449 0 * = 449 0 CCTTCCTGTTCGCCTCTATTTTCGCCGCCTGTCTTGTCATCCCCGTCTGTTCATTCGTTACATGCGCCTTATTATTTCCTCCTCCC
TTCCATTTTTGTTCTTCGTGTTCTC 21221011AA2/////112A2A2////////11@@1B12@21/////>/1222>2>200//1>21////?11B22>222110000/01001@22@1/00<1<1/0//0111 YT:Z:UP

My second query is how to find out the paired-read aligned in reverse order (strand) of the reference?

Please help.

Thanks.

Gopal
gopal_botany is offline   Reply With Quote
Reply

Tags
alignment, bowtie, bowtie2, pipeline, rna-seq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:15 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO