SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
illumina small RNA sample prep v1.5 won337 Illumina/Solexa 7 03-31-2015 07:02 AM
Sample/library prep of DNA and RNA in a metagenomic sample chrisaw01 Metagenomics 1 05-05-2011 01:59 PM
Small RNA sample prep images Kaisee RNA Sequencing 0 10-28-2010 12:59 PM
Sample prep for RNA-seq from low abundance RNA chadn737 RNA Sequencing 7 06-15-2010 06:49 AM
small DNA sample library prep vlee2 454 Pyrosequencing 3 05-22-2009 11:55 AM

Reply
 
Thread Tools
Old 02-24-2009, 10:19 PM   #1
jujuhi
Junior Member
 
Location: Europe

Join Date: Feb 2009
Posts: 4
Default Small RNA Sample Prep v1.5.0

Hi all, does anyone already used new version 1.5. in small RNA sampling? Difference is in 3' adapter sequence that need to be pre-adenylated I guess, if T4 RNA ligase 2 will be used. Does anyone have sequence for this new adapter? That would be very handy....
jujuhi is offline   Reply With Quote
Old 03-05-2009, 12:15 AM   #2
odelfour
Junior Member
 
Location: Toulouse, France

Join Date: Oct 2008
Posts: 6
Default

I'm also interested in people having already used this novel prep. kit.
It seems much easier and faster for seqeuncing one sample.
Does anyone already use it ?
How many reads do you obtain ? With which quality ?

best,

olivier
odelfour is offline   Reply With Quote
Old 03-05-2009, 07:08 AM   #3
Kameron
Junior Member
 
Location: Germany

Join Date: Jan 2009
Posts: 1
Default

Hi all,

im also interested in the sequence of this new adapter. Tomorrow i will start with the library preparation using the alternative v1.5 Protocol.
I am also planning a comparison of different input RNA (Total RNA and gel purified small RNA). I will report back.
Kameron is offline   Reply With Quote
Old 03-05-2009, 07:13 AM   #4
odelfour
Junior Member
 
Location: Toulouse, France

Join Date: Oct 2008
Posts: 6
Default

Hi Kameron,

Thank's for your contribution.

olivier
odelfour is offline   Reply With Quote
Old 04-24-2009, 08:57 PM   #5
Malabady
Member
 
Location: Illinois, USA

Join Date: Apr 2009
Posts: 12
Default

hi,
The sequence of v1.5 3' small RNA adapter is
5'- ATCTCGTATGCCGTCTTCTGCTTG.
I tried the new protocol. Yes it is faster but it is not as accurate as the old one. Since there is no any gel purification step included until the last step, the target fragment is embedded in high background of degraded RNA. So it is not easy to excise especially when its faint band. I am planning to purify small RNA using denaturing Urea gel and then use this short protocol.....I will let you know
Malabady is offline   Reply With Quote
Old 06-25-2009, 08:01 AM   #6
davcast
Junior Member
 
Location: Paris, France

Join Date: Mar 2009
Posts: 2
Default

Hello,

Would anybody know the concentration of the v1.5 3' small RNA adapter either before or after 10X dilution?
Thanks for your reply

david
davcast is offline   Reply With Quote
Old 07-30-2009, 04:50 PM   #7
dandestroy
Junior Member
 
Location: Boston

Join Date: Jul 2008
Posts: 3
Default

10M before dilution
dandestroy is offline   Reply With Quote
Old 08-27-2009, 03:02 AM   #8
jujuhi
Junior Member
 
Location: Europe

Join Date: Feb 2009
Posts: 4
Default

We also tried with enriched miRNAs after Novex gel. Did not work either... We got library but size more than 10 times smaller compared to old 1.0 kit. I also ran samples after ligations to Bioanalyzer and it seems to be that ligations in new kit do not work properly. Someone similar problems? Now we are using old kit with much better results but unfortunately more hands in time.
jujuhi is offline   Reply With Quote
Old 08-27-2009, 03:59 AM   #9
odelfour
Junior Member
 
Location: Toulouse, France

Join Date: Oct 2008
Posts: 6
Default

Hi,
Which protocol did you use to extract total RNA ? seems that many small rna can be lost depending of the extraction protocole used.

And what is RNA quantity to you use with the 1.5 kit ?

I guess with the old one, you load at least 10 microg.




Quote:
Originally Posted by jujuhi View Post
We also tried with enriched miRNAs after Novex gel. Did not work either... We got library but size more than 10 times smaller compared to old 1.0 kit. I also ran samples after ligations to Bioanalyzer and it seems to be that ligations in new kit do not work properly. Someone similar problems? Now we are using old kit with much better results but unfortunately more hands in time.
odelfour is offline   Reply With Quote
Old 08-27-2009, 04:29 AM   #10
jujuhi
Junior Member
 
Location: Europe

Join Date: Feb 2009
Posts: 4
Default

We have optimized that relatively lot and Trizol works the best in our hands. MiRVANA was the second best. According bioanalyzer we have plenty of miRNA in our samples. We have also sequenced same sample prepared by kit 1.0 and kit 1.5. Results showed that there were 75% less reads that align to genome in sample prepared by kit 1.5 .

We have also tried different starting RNA quantities in 1.5 kit. 1 and 10 g without 15% Novex fragmentation and 10 g with Novex (like in kit 1.0). There is no difference in library yield. The problem is in ligation I think. It seems to come a lot of adapter dimers compare to right size miRNAs.

Cheers, J
jujuhi is offline   Reply With Quote
Old 09-14-2009, 09:20 PM   #11
zhangww
Junior Member
 
Location: USA

Join Date: Sep 2009
Posts: 2
Default

Hi all, I used the new protocol with enriched miRNAs after Novex gel.For the plant samples, the results showed that

the 1.5 kit do not work properly. TA cloning was used to validate the library, and fewer miRNA would be found in it.

Anyone meet similar problems? Does the 3 adapter has some bias in the ligation of some others sequences (rRNA etc.)? I think the new protocol need to be improved.


Quote:
Originally Posted by jujuhi View Post
We have optimized that relatively lot and Trizol works the best in our hands. MiRVANA was the second best. According bioanalyzer we have plenty of miRNA in our samples. We have also sequenced same sample prepared by kit 1.0 and kit 1.5. Results showed that there were 75% less reads that align to genome in sample prepared by kit 1.5 .

We have also tried different starting RNA quantities in 1.5 kit. 1 and 10 g without 15% Novex fragmentation and 10 g with Novex (like in kit 1.0). There is no difference in library yield. The problem is in ligation I think. It seems to come a lot of adapter dimers compare to right size miRNAs.

Cheers, J
zhangww is offline   Reply With Quote
Old 09-26-2009, 05:23 PM   #12
Rod
Junior Member
 
Location: Canberra

Join Date: Sep 2009
Posts: 1
Default v1.5 adaptors ligate without inserts

Hi all,

I'm preparing small RNA samples for v1.5 single end reads. After the cDNA library generation I've checked that the constructs contain each adaptor and an insert on a PAGE gel and see bands of the correct size (around 100nt). I have cloned the inserts into a plasmid and PCR amplified the construct from here and the size still looks good. However, when I Sanger sequence (for final validation) the cloned products I continually see the adaptors ligated together with no inserts. Has anybody else had this experience?
Rod is offline   Reply With Quote
Old 09-29-2009, 10:35 PM   #13
davcast
Junior Member
 
Location: Paris, France

Join Date: Mar 2009
Posts: 2
Default

Hi Rod,
it seems you don't clone you small RNA. if you are following the illumina protocol, you often see two bands: one corresponding to the adapters dimers and up by 20-25 nt your cloned library. if you only see one band with the one step protocol (no gel purification after each ligation/RT), i doubt you successfully cloned your smalls.
Maybe check you have small RNA in you extract (on bioanalyzer).
good luck
david
davcast is offline   Reply With Quote
Old 10-23-2009, 10:35 AM   #14
Marta
Member
 
Location: Davis, CA

Join Date: Oct 2009
Posts: 17
Default

The new v1.5 small RNA prep protocol seems to be working fine for me. I just finished analysis where I compared how many tags from the specific gene, and from tRNAs, rRNAs, and chloroplasts we got using the old and new protocols. Everything seems to be very similar. Do you have any other ideas how to evaluate the small RNA libraries?
Marta is offline   Reply With Quote
Old 07-25-2010, 10:01 PM   #15
westlook
Junior Member
 
Location: china

Join Date: Sep 2009
Posts: 1
Default

hi,all

In some of our v1.5 Small RNA libraries,there are some strange sequences,most of which contain a sequence--" ATTTTGATTCCAACTTTTATCGTAAGGG ", It can match to Arabidopsis thaliana genome, and it even appeared largely in some anmial samples.How these sequence come out? Do you have any experiences or opions about it?

Thanks
westlook is offline   Reply With Quote
Old 07-27-2010, 06:34 PM   #16
link1
Member
 
Location: US

Join Date: May 2010
Posts: 21
Default small mirna protocol

westlook, not sure what that sequence is....screened my results, haven't seen it.

for the other folks in the forum, I've gotten the miRNA protocol to work consistently now (30th library today). the most important things I've found are the quality of your starting material and that the ratio of miRNA to adenylated adapter should be ~ 1:10. Let me know if you're having trouble and I can help.
link1 is offline   Reply With Quote
Old 09-15-2010, 06:33 AM   #17
bomper
Junior Member
 
Location: spain

Join Date: Sep 2010
Posts: 1
Default

Hi,

I'm using the Illumina small RNA v1.5 kit and i would like know what is the yield. Anybody knows it?
Many Thanks!
bomper is offline   Reply With Quote
Old 11-19-2010, 11:10 PM   #18
DMO
Member
 
Location: USA

Join Date: Aug 2010
Posts: 28
Default

Has anyone attempted prepping small RNA from degraded Total RNA (RIN 2.5-3)? Any luck?
DMO is offline   Reply With Quote
Old 04-05-2011, 10:01 AM   #19
cascoamarillo
Senior Member
 
Location: MA

Join Date: Oct 2010
Posts: 160
Default

Hi,

I do have the same question; someone attempting to do a small RNA library from total RNA vs. previously selected small RNA. Does it carry any difference in the final gel (clear bands, lost of potential material...)?. Has anyone done this with Illumina, NEB, etc. small RNA kits?

Regards.
cascoamarillo is offline   Reply With Quote
Old 11-21-2011, 10:10 PM   #20
nirwalniraj
Junior Member
 
Location: India

Join Date: Oct 2011
Posts: 4
Default

I had prepared library for c. elegans small RNA sequencing using v1.5 small RNA illumina kit. I used 6% native DNA-PAGE to run the samples and cut down only the band near to 100 bp. I should got 93 and 100 bp bands in all the samples after PCR enrichment but i got only 100-102 bp and 106-109 in the other samples after agilent bioanalyzer analysis. Please suggest me, whether i should go for downstream processing (sequencing by genome analyzer) or not with these samples.
nirwalniraj is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:06 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO