SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
SHRiMP alignment results for colorspace miRNA dsidote Bioinformatics 2 11-10-2011 09:32 AM
view alignment and assembling results with UCSC genome browser? dicty Bioinformatics 1 03-04-2011 07:38 AM
BWA results without coordinates Francesco Lescai Bioinformatics 3 04-09-2010 02:18 AM
BWA odd behaviors jmartin Bioinformatics 4 04-07-2010 07:53 AM
BWA samse results combiochem Bioinformatics 1 11-16-2009 10:22 AM

Reply
 
Thread Tools
Old 11-27-2011, 08:40 PM   #1
dandyrilla
Junior Member
 
Location: Seoul, Korea

Join Date: Aug 2011
Posts: 2
Default BWA produces odd alignment results

I tried to get a uniquely mapped reads from BWA alignment, so I filtering out the alignments without XT:A:U in SAM line.

However, BWA produces odd aligned reads, which is both unmapped and uniquely mapped.

These reads below have both SAM flag which means 'reads unmapped' and mapping position.(chrom, pos)

How can that be? Have you ever gotten such reads?

SRR101341.21640516 4 chr3 199501827 0 33M * 0 0 GACCCTAACCCTAACCCTAACCCTAACCCTAAC 0)@@)?''0-68?09384;<5=)A;56@>167: XT:A:U NM:i:0 XN:i:1 X0:i:1 X1:i:557 XM:i:0 XO:i:0 XG:i:0 MD:Z:33

SRR101344.29575296 133 chr11 134452345 15 43M chr12 92723370 0 TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGAGG CCCCCCCCCCCCCCCCCCDCCCCCDCCCCCBB@CCCBCCCC@C XT:A:U NM:i:0 XN:i:3 SM:i:15 AM:i:0 X0:i:1 X1:i:6 XM:i:0 XO:i:0 XG:i:0 MD:Z:43 XA:Z:chr3,+199385175,43M,1;chrX,+154913557,43M,1;chrY,+57772757,43M,1;chr11,+134452000,43M,1;chr1,-397,43M,1;chr18,-25,43M,1;

thanks (^______^)

Last edited by dandyrilla; 11-27-2011 at 08:48 PM.
dandyrilla is offline   Reply With Quote
Old 11-27-2011, 10:47 PM   #2
swbarnes2
Senior Member
 
Location: San Diego

Join Date: May 2008
Posts: 912
Default

bwa concatenates reference sequences together, and if a read hangs off of one reference, and onto another, bwa will both give it a mapping position, and a 4 flag.

More commonly, sam specs call for the unmapped read of a pair to be given the mapping position of its mapped mate, and the 4 flag.

But from your coordinates, I'm betting that the first is the answer.
swbarnes2 is offline   Reply With Quote
Old 11-27-2011, 11:28 PM   #3
dandyrilla
Junior Member
 
Location: Seoul, Korea

Join Date: Aug 2011
Posts: 2
Default Why 'XT:A:U' is in the unmapped line?

Thanks, swbarnes2!

And then,
why 'XT:A:U' is in the unmapped line?

I know that 'XT:A:U' means uniquely mapped read.
Is it right?
What does it mean?
dandyrilla is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:13 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO