Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Ion Torrent reverse primer - P1 or B

    In designing reverse primer for amplicon Ion Torrent, should I use B adapter (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG) or P1 adapter (CCTCTCTATGGGCAGTCGGTGAT)? I have two Ion Torrent application notes, both dated 2011, and they have conflicting information. Also, the B-adapter design contains the key sequence TCAG, but P1 does not. Is that right that when I use the P1 adapter, the B adapter and key are added in e-PCR?

  • #2
    Can you post the application notes that you have? I am trying to design some amplicon primers, but the only note that I have shows the P1 adapter.

    Comment


    • #3
      Originally posted by Retro View Post
      In designing reverse primer for amplicon Ion Torrent, should I use B adapter (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG) or P1 adapter (CCTCTCTATGGGCAGTCGGTGAT)? I have two Ion Torrent application notes, both dated 2011, and they have conflicting information. Also, the B-adapter design contains the key sequence TCAG, but P1 does not. Is that right that when I use the P1 adapter, the B adapter and key are added in e-PCR?
      The current version of the Amplicon Sequencing application note is posted on the Ion Community and also on the Applications page of the Ion Torrent website:





      This strategy employs A and P1-tagged fusion primers.

      Comment


      • #4
        The version with P1 reverse primer is here:


        The version with B reverse primer:


        The version with P1 seems more recent, so probably correct. However, I guess the B and key will be added in the e-PCR. That will only make the 3' end adapter end longer by the 23 bp of the P1 sequence. This will further limit the size for the specific insert in the already limited range in Ion Torrent.

        Comment


        • #5
          Adapter B was discontinued mid 2011.

          Use Adapters A and P1

          Comment


          • #6
            When I use P1, will the B and TCAG key be still present in the sequence reads?

            Comment


            • #7
              OK, just to answer to myself, even when P1 primer is used, the primer B and "TCAG key sequence" are present at the ends of the reads. They must be present on the beads.

              Comment


              • #8
                Originally posted by Retro View Post
                OK, just to answer to myself, even when P1 primer is used, the primer B and "TCAG key sequence" are present at the ends of the reads. They must be present on the beads.
                You might want to read this thread again. There is no primer/adapter B.

                P1 and A are the current sequences.

                Comment


                • #9
                  To SeAA:

                  You are right, P1 and A are the current sequences. Previous version of Ion Torrent amplicon method had primers A and B. Since my original question , we performed the sequencing with A-P1 amplicons. In reads that are long enough, the 3' end contains the P1 primer, followed by the TCAG key sequence and B primer sequence. That probably means that the beads contain B sequence with the TCAG key. Notice that the new version of the Ion Torrent protocol does not have the key sequence in the P1 primer, it did have it in the previous version with the B primer. For some reason they decided to switch the way the 3' end is amplified.

                  It is also interesting that all these primers are from other NGS technologies, A and B is from 454 and P1 from some other, not sure now. Probably to make it easier for users to switch to Ion Torrent, which is what we did from 454.

                  Comment


                  • #10
                    I just called with Ion Torrent technical help and they confirmed that even when the A-P1 combination of primers is used, the B adapter will be at the end of the long reads, because it is present on the beads.

                    Comment

                    Latest Articles

                    Collapse

                    • seqadmin
                      Current Approaches to Protein Sequencing
                      by seqadmin


                      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                      04-04-2024, 04:25 PM
                    • seqadmin
                      Strategies for Sequencing Challenging Samples
                      by seqadmin


                      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                      03-22-2024, 06:39 AM

                    ad_right_rmr

                    Collapse

                    News

                    Collapse

                    Topics Statistics Last Post
                    Started by seqadmin, 04-11-2024, 12:08 PM
                    0 responses
                    30 views
                    0 likes
                    Last Post seqadmin  
                    Started by seqadmin, 04-10-2024, 10:19 PM
                    0 responses
                    32 views
                    0 likes
                    Last Post seqadmin  
                    Started by seqadmin, 04-10-2024, 09:21 AM
                    0 responses
                    28 views
                    0 likes
                    Last Post seqadmin  
                    Started by seqadmin, 04-04-2024, 09:00 AM
                    0 responses
                    53 views
                    0 likes
                    Last Post seqadmin  
                    Working...
                    X