SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Ion Torrent



Similar Threads
Thread Thread Starter Forum Replies Last Post
Ion Torrent $1000 Genome!? Benchtop Ion Proton Sequencer aeonsim Ion Torrent 88 10-28-2012 04:50 AM
Ion torrent blog on raw accuracy - good primer for accuracy grand challenge lek2k Ion Torrent 3 09-20-2011 12:13 AM
ion torrent herrroaa Introductions 5 07-25-2011 05:36 AM
Ion Torrent through the roof... james hadfield Ion Torrent 14 03-21-2011 09:34 AM
Ion Torrent in Cambridge! asr Ion Torrent 6 03-17-2011 11:32 AM

Reply
 
Thread Tools
Old 01-29-2012, 06:46 PM   #1
Retro
Member
 
Location: Pennsylvania

Join Date: Apr 2011
Posts: 27
Default Ion Torrent reverse primer - P1 or B

In designing reverse primer for amplicon Ion Torrent, should I use B adapter (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG) or P1 adapter (CCTCTCTATGGGCAGTCGGTGAT)? I have two Ion Torrent application notes, both dated 2011, and they have conflicting information. Also, the B-adapter design contains the key sequence TCAG, but P1 does not. Is that right that when I use the P1 adapter, the B adapter and key are added in e-PCR?
Retro is offline   Reply With Quote
Old 01-30-2012, 05:10 AM   #2
bbeitzel
Member
 
Location: Ft. Detrick, MD

Join Date: Aug 2008
Posts: 50
Default

Can you post the application notes that you have? I am trying to design some amplicon primers, but the only note that I have shows the P1 adapter.
bbeitzel is offline   Reply With Quote
Old 01-30-2012, 06:11 AM   #3
IonTorrent
Member
 
Location: Guilford, CT and S.F., CA

Join Date: Jan 2010
Posts: 64
Default

Quote:
Originally Posted by Retro View Post
In designing reverse primer for amplicon Ion Torrent, should I use B adapter (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG) or P1 adapter (CCTCTCTATGGGCAGTCGGTGAT)? I have two Ion Torrent application notes, both dated 2011, and they have conflicting information. Also, the B-adapter design contains the key sequence TCAG, but P1 does not. Is that right that when I use the P1 adapter, the B adapter and key are added in e-PCR?
The current version of the Amplicon Sequencing application note is posted on the Ion Community and also on the Applications page of the Ion Torrent website:

http://lifetech-it.hosted.jivesoftwa.../docs/DOC-1451

http://www.iontorrent.com/lib/images...ote_040411.pdf

This strategy employs A and P1-tagged fusion primers.
IonTorrent is offline   Reply With Quote
Old 01-30-2012, 06:16 AM   #4
Retro
Member
 
Location: Pennsylvania

Join Date: Apr 2011
Posts: 27
Default

The version with P1 reverse primer is here:
http://www.iontorrent.com/lib/.../am...ote_040411.pdf

The version with B reverse primer:
http://www.genesyschile.cl/wp.../amp...ote_012011.pdf

The version with P1 seems more recent, so probably correct. However, I guess the B and key will be added in the e-PCR. That will only make the 3' end adapter end longer by the 23 bp of the P1 sequence. This will further limit the size for the specific insert in the already limited range in Ion Torrent.
Retro is offline   Reply With Quote
Old 01-30-2012, 09:36 AM   #5
SeqAA
Guest
 

Posts: n/a
Default

Adapter B was discontinued mid 2011.

Use Adapters A and P1
  Reply With Quote
Old 01-30-2012, 09:56 AM   #6
Retro
Member
 
Location: Pennsylvania

Join Date: Apr 2011
Posts: 27
Default

When I use P1, will the B and TCAG key be still present in the sequence reads?
Retro is offline   Reply With Quote
Old 02-21-2012, 05:53 PM   #7
Retro
Member
 
Location: Pennsylvania

Join Date: Apr 2011
Posts: 27
Default

OK, just to answer to myself, even when P1 primer is used, the primer B and "TCAG key sequence" are present at the ends of the reads. They must be present on the beads.
Retro is offline   Reply With Quote
Old 02-22-2012, 10:31 PM   #8
SeqAA
Guest
 

Posts: n/a
Default

Quote:
Originally Posted by Retro View Post
OK, just to answer to myself, even when P1 primer is used, the primer B and "TCAG key sequence" are present at the ends of the reads. They must be present on the beads.
You might want to read this thread again. There is no primer/adapter B.

P1 and A are the current sequences.
  Reply With Quote
Old 02-23-2012, 06:13 AM   #9
Retro
Member
 
Location: Pennsylvania

Join Date: Apr 2011
Posts: 27
Default

To SeAA:

You are right, P1 and A are the current sequences. Previous version of Ion Torrent amplicon method had primers A and B. Since my original question , we performed the sequencing with A-P1 amplicons. In reads that are long enough, the 3' end contains the P1 primer, followed by the TCAG key sequence and B primer sequence. That probably means that the beads contain B sequence with the TCAG key. Notice that the new version of the Ion Torrent protocol does not have the key sequence in the P1 primer, it did have it in the previous version with the B primer. For some reason they decided to switch the way the 3' end is amplified.

It is also interesting that all these primers are from other NGS technologies, A and B is from 454 and P1 from some other, not sure now. Probably to make it easier for users to switch to Ion Torrent, which is what we did from 454.
Retro is offline   Reply With Quote
Old 03-12-2012, 11:13 AM   #10
Retro
Member
 
Location: Pennsylvania

Join Date: Apr 2011
Posts: 27
Default

I just called with Ion Torrent technical help and they confirmed that even when the A-P1 combination of primers is used, the B adapter will be at the end of the long reads, because it is present on the beads.
Retro is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:14 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO