
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Forcing paired-end data mapped as single-end in SAM puggie Bioinformatics 1 03-16-2013 10:50 AM
50 bp Single end Vs 100 bp Single end Vs 50 bp Paired end dhanapala RNA Sequencing 4 06-08-2012 05:09 PM
Paired-end Bam from single-end aligned sam ramouz87 Bioinformatics 4 08-17-2011 12:55 PM
SAM file for paired-end ECHo RNA Sequencing 0 04-21-2011 10:55 PM
BOth single and paired end reads in a file!! adgen Illumina/Solexa 0 06-30-2010 10:28 AM

Thread Tools
Old 08-10-2013, 06:39 AM   #1
Junior Member
Location: eu

Join Date: May 2013
Posts: 4
Smile Given BAM/SAM file, where to find its read length information?

Given BAM/SAM file(for example the BAM file I posted below), where to find its read length information?
Thank you!!

a BAM file by samtool view

SL-XAN_2_FC30BV1AAXX:1:47:1108:971 161 chrM 2 37 51M = 416 0 ATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTT 77777777777777777777777777777766644122122222222.222 XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51
SL-XAN_2_FC30BV1AAXX:1:17:1367:1052 97 chrM 3 37 51M = 411 0 TCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTT 77777777777777777777777777777774+44-222222/2222222" XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:50G0
SL-XAN_2_FC30BV1AAXX:1:48:1493:1675 161 chrM 3 37 51M = 396 0 TCACAGGGCTATCACCCTATTAACCACTCACGGGAGCGCTCCATGCATTTG 66,66666666666666666(66666666$66'6+,2'22!)'2,22,222 XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:7T29T13
SL-XAN_2_FC30BV1AAXX:1:2:1699:495 1121 chrM 3 37 51M = 411 0 TCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTT 7753577770757777777777777-777-71+1'/22221/%2/2*222" XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:50G0
SL-XAN_2_FC30BV1AAXX:1:94:521:1276 97 chrM 4 37 51M = 326 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGG 77777777777777777777777777777707777222222/2/2*222/% XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51
SL-XAN_2_FC30BV1AAXX:1:38:989:254 97 chrM 4 37 51M = 416 0 CACAGGGCTATCACCCTCTTAACCACTCACGGGAGCTCTCCGTGCATTTGC 777707(77.777777((77(.77-3.777-/+17,#2222%21*-1*2(% XT:A:U NM:i:4 X0:i:1 X1:i:0 XM:i:4 XO:i:0 XG:i:0 MD:Z:6T10A23A8G0
SL-XAN_2_FC30BV1AAXX:1:13:1440:514 1121 chrM 4 37 51M = 108 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGT 777777777777777777777777777777777%72222221222-222-% XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:50G0
SL-XAN_2_FC30BV1AAXX:1:4:428:1682 1121 chrM 4 37 51M = 327 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGG 77777777777777777777777777777747477222222-2)2%222%% XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51
SL-XAN_2_FC30BV1AAXX:1:55:771:1939 1121 chrM 4 37 51M = 327 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGG 777777.777777777777777777777777+3-12221-2-2/1*222%+ XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51
SL-XAN_2_FC30BV1AAXX:1:53:1454:1186 97 chrM 4 37 51M = 108 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGG 77777777777777777777777777777777477222222%212-2221% XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:51

Last edited by xxatbio; 08-10-2013 at 07:38 AM.
xxatbio is offline   Reply With Quote
Old 08-11-2013, 02:48 AM   #2
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480

It's just the length of the 10th column (the sequence). Note that the reads can be of different lengths, particularly if they were trimmed.
dpryan is offline   Reply With Quote
Old 08-11-2013, 02:51 AM   #3
Junior Member
Location: eu

Join Date: May 2013
Posts: 4
Thumbs up

Originally Posted by dpryan View Post
It's just the length of the 10th column (the sequence). Note that the reads can be of different lengths, particularly if they were trimmed.
Thank you !
xxatbio is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 03:47 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO