SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Custom Sequencing Primers abbecker Illumina/Solexa 0 01-11-2018 01:34 AM
miseq custom primers barturas Illumina/Solexa 1 07-01-2013 05:46 AM
PubMed: Hybrid selection of discrete genomic intervals on custom-designed microarrays Newsbot! Literature Watch 0 05-30-2009 05:07 AM

Reply
 
Thread Tools
Old 09-19-2020, 12:19 PM   #1
transposn
Junior Member
 
Location: Maryland

Join Date: Apr 2016
Posts: 2
Default how custom primers should be designed?

I am wondering whether my experiment (which was originally designed to work on a HiSeq) will work on NextSeq and MiSeq.

I have been making small RNA library that we send out to sequence in a HiSeq but we want to try to sequence it in our lab (MiSeq and/or NextSeq). The protocol we are using is a modified version of the Illumina TruSeq Small RNA in which the 3’ and 5’ adapters have been modified as well as the final adapters.

These are the final adapters (index) that are added in a final enrichment step to the samples:

Forward: AATGATACGGCGACCACCGAGATCTACACGACAGGTTCAGAGTTCTACAGTCCGACGA*T*C

Reverse: CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T

Note: NNNNNN (index)

Illumina Tech Support for help they gave us an option to design Custom Sequencing Primer but i have no idea how to design them.

Do you guys have any ideas or recommendations how custom primers should be designed?

Thank you very much!

Last edited by transposn; 09-19-2020 at 12:30 PM.
transposn is offline   Reply With Quote
Old 09-21-2020, 07:17 AM   #2
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,178
Default

If your libraries functioned on a HiSeq then they will function on a MiSeq or NextSeq. Any valid Illumina library will work with any of their currently supported instruments.
kmcarr is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:21 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO