SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie Paired-end options days369 Bioinformatics 5 12-12-2012 04:38 PM
Paired End Mapping using Bowtie adarshjose Bioinformatics 8 01-26-2012 07:41 AM
bowtie- paired end - no alignments madsaan Bioinformatics 1 06-27-2011 01:24 PM
bowtie paired end mismatches madsaan Bioinformatics 0 06-22-2011 08:26 AM
Soap2 paired end mode rahul.m.dhodapkar Bioinformatics 1 08-25-2010 07:18 AM

Reply
 
Thread Tools
Old 08-18-2010, 03:19 AM   #1
boetsie
Senior Member
 
Location: NL, Leiden

Join Date: Feb 2010
Posts: 245
Default bowtie paired end mode

hi all,

i want to use bowtie for sort of paired end alignment, when i do;

bowtie.exe TESTTT -c CACCGAAAGACA,AGTAGCCACGGCGCAGCAACAC

it works fine, and i get two outputs.

However, when i do them in paired end mode;

bowtie.exe TESTTT -1 file1.txt -2 file2.txt

it doesn't work, since it generates no outputs. Someone knows how to generate such a file? Can it be a .fasta file?

Cheers,
Marten
boetsie is offline   Reply With Quote
Old 08-18-2010, 04:12 AM   #2
adamdeluca
Member
 
Location: Iowa City, IA

Join Date: Jul 2010
Posts: 95
Default

http://bowtie-bio.sourceforge.net/manual.shtml

-f specifies fasta, by default fastq is assumed
adamdeluca is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:16 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO