SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
SOLiD paired-end mapping yaira04 SOLiD 6 12-12-2012 04:41 PM
Paired-end Solexa data mapping wit Bowtie rebrendi Bioinformatics 21 03-30-2012 12:31 PM
Can paired-end mapping produce more reads than single-end ? warrenemmett Bioinformatics 13 03-20-2012 11:10 PM
Is it a software that can show paired end mapping? songsy Bioinformatics 3 11-04-2011 04:30 PM
Fastq: Paired end reads and mapping cedance Bioinformatics 7 06-18-2011 12:33 PM

Reply
 
Thread Tools
Old 02-09-2011, 06:10 PM   #1
adarshjose
Junior Member
 
Location: ames IA

Join Date: Jul 2010
Posts: 6
Default Paired End Mapping using Bowtie

I am trying to map Illumina GA II E paired end reads to a reference genome.
More than 80 % of the reads map when using single end mapping, but virtually none of the reads map when I am using paired end mapping.
Can some one please have a look at the commands I am using and a typical example of a read I have pasted below ? Any suggestions are welcome.

Thanks in advance

Adarsh Jose
BCB, Iowa State University

I am using the following commands:

# paired end
bowtie Ref/ZmB73_RefGenome -1 sample_s4_1.fastq -2 sample_s4_2.fastq s4PairedMapping.map -n 2 -e 250 -l 30 -I 400 -X 460 -m 10 --time --un Unmappedpaireds4 --max Multipaireds4 -S -p 4 --verbose

# single end
bowtie Ref/ZmB73_RefGenome sample_s4_1.fastq s4SingleMapping_1.map -e 250 -l 30 -m 10 --time --un Unmappedsingles4_1 --max Multisingles4_1 -p 4
bowtie Ref/ZmB73_RefGenome sample_s4_2.fastq s4SingleMapping_2.map -e 250 -l 30 -m 10 --time --un Unmappedsingles4_2 --max Multisingles4_2 -p 4

# An example mapping of a read pair

# Single end Pair1
ILLUMINA-4750D6_00031:4:1:10005:2856#0/1 + chromosome:AGPv2:2:1:237068873:1 32492480 CGGCGATATAAAATAAACAACTCAGAAGCAAATCGACCCCAGAAGCCCGTCTTAC ffafff]_dfac\\\cccfcccfcf]d^]b`b[`R`dbb`bcccad`J]`b^R]^ 0 2:A>G

# Single end Pair2
ILLUMINA-4750D6_00031:4:1:10005:2856#0/2 - chromosome:AGPv2:2:1:237068873:1 32492560 CCATGGCATCCGCTTCCTCCTCCCAGCAGAGAAGATTAGCCAGCTTGTAGTCCTTCTTCATAGGAGG ^]dbddd[Z^^[Z\U`^Icf[fehhhaefgh_ffdffd]_ffechehfccfa`X]^]T`]a\aaaad 0

#Paired End
ILLUMINA-4750D6_00031:4:1:10005:2856#0 141 * 0 0 * * 0 0 CCTCCTATGAAGAAGGACTACAAGCTGGCTAATCTTCTCTGCTGGGAGGAGGAAGCGGATGCCATGG daaaa\a]`T]^]X`afccfhehceff_]dffdff_hgfeahhhef[fcI^`U\Z[^^Z[dddbd]^ XM:i:0

ILLUMINA-4750D6_00031:4:1:10005:2856#0 77 * 0 0 * * 0 0 CGGCGATATAAAATAAACAACTCAGAAGCAAATCGACCCCAGAAGCCCGTCTTAC ffafff]_dfac\\\cccfcccfcf]d^]b`b[`R`dbb`bcccad`J]`b^R]^ XM:i:0

Last edited by adarshjose; 02-09-2011 at 06:22 PM.
adarshjose is offline   Reply With Quote
Old 03-31-2011, 08:55 AM   #2
lakshmaa
Member
 
Location: Boston

Join Date: Jun 2010
Posts: 11
Default

I am having the same problem. Did anyone solve it ?

Thanks

Last edited by lakshmaa; 03-31-2011 at 08:57 AM.
lakshmaa is offline   Reply With Quote
Old 03-31-2011, 09:03 AM   #3
adarshjose
Junior Member
 
Location: ames IA

Join Date: Jul 2010
Posts: 6
Default Solution

It is a parsing problem. The reads in both the files have to be in the same order. That is, if the 5th read in pair_1.fastq is A, then the corresponding 5th read in pair_2.fastq must also be A.

To illustrate:

This will work:

pair_1.fastq

1. >readA /1
2. >readB /1
3. >readC /1
4. >readD /1

pair_2.fastq

1. >readA /2
2. >readB /2
3. >readC /2
4. >readD /2

but here only the 1st read pairs- readA will get mapped.


pair_1.fastq

1. >readA /1
2. >readC /1
3. >readD /1

pair_2.fastq

1. >readA /2
2. >readB /2
3. >readC /2
4. >readD /2
adarshjose is offline   Reply With Quote
Old 03-31-2011, 09:04 AM   #4
lakshmaa
Member
 
Location: Boston

Join Date: Jun 2010
Posts: 11
Default

Thank you ! I will look into it
lakshmaa is offline   Reply With Quote
Old 01-26-2012, 02:25 AM   #5
nilmot13
Member
 
Location: Leeds, UK

Join Date: Jan 2011
Posts: 19
Default

Hi,

I'm new to using Bowtie for paired-end mapping and too have encountered the same issue.

Did you manage to solve the parsing problem? or is there a way to program bowtie to come around the problem?

Many thanks
nilmot13 is offline   Reply With Quote
Old 01-26-2012, 06:26 AM   #6
adarshjose
Junior Member
 
Location: ames IA

Join Date: Jul 2010
Posts: 6
Default Its is a parsing problem

I don't think Bowtie takes care of this. Both the files must have the reads in the same order. Please have a look at my previous post.
adarshjose is offline   Reply With Quote
Old 01-26-2012, 07:08 AM   #7
nilmot13
Member
 
Location: Leeds, UK

Join Date: Jan 2011
Posts: 19
Default

Hmm do you have any suggestion as to how to combat this issue?

After clipping adaptor sequencing and trimming, often read2 becomes very short and poor in quality, which will get discarded. Do you think maintaining as much reads as possible would reduce this type of error?
nilmot13 is offline   Reply With Quote
Old 01-26-2012, 07:28 AM   #8
adarshjose
Junior Member
 
Location: ames IA

Join Date: Jul 2010
Posts: 6
Default Split the reads into those with and without pairs

Just split the reads after filtering into those with and without pairs. Use paired end mapping for the cases where both reads are retained after filtering and unpaired mapping for the remaining reads.
adarshjose is offline   Reply With Quote
Old 01-26-2012, 07:41 AM   #9
nilmot13
Member
 
Location: Leeds, UK

Join Date: Jan 2011
Posts: 19
Default

Thank you for the advise.

Sorry for replying very simple question. I'm really an experimental biologist, not an experience bioinformatician. Is there a FASTQ manipulation tool or command that allows you to apply the filter for pairs?
nilmot13 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:10 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO