SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Adapter sequence trimming cew85911 Bioinformatics 2 11-19-2013 02:53 AM
Adapter trimming and trimming by quality question alisrpp Bioinformatics 5 04-08-2013 04:55 PM
adapter trimming - help a_mt Bioinformatics 6 11-12-2012 07:36 PM
Adapter Trimming Nextera mm.perrineau Illumina/Solexa 1 09-12-2012 10:56 AM
3' Adapter Trimming caddymob Bioinformatics 0 05-27-2009 12:53 PM

Reply
 
Thread Tools
Old 04-07-2014, 09:58 AM   #1
figo1019
Member
 
Location: germany

Join Date: Jun 2012
Posts: 32
Default Adapter trimming

Hi

I have got the adapter sequences from company as for Illumina RNA seq data:
5-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC-(insert)-ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGXXXXXXTAGAGCATACGGCAGAAGACGAAC-3

(ID #1 "ATCACG" )

Will this be my adapter sequences to trim it using trimmomatic?
>adpter1
AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC
>adapter2
ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGATCACGTAGAGCATACGGCAGAAGACGAAC

or I have to reverse complement the adapter ?

Best Regards
figo1019 is offline   Reply With Quote
Old 04-07-2014, 10:58 AM   #2
mastal
Senior Member
 
Location: uk

Join Date: Mar 2009
Posts: 659
Default

Have a look at the TruSeq adapter files that come with trimmomatic,
and see how they compare to the sequences you have.
mastal is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:57 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO