Hi,
I'm analyzing SNPs and Indels called from alignments. I always observed indels described as in the following example:
The wild-type sequence here is "ATCT" and the alternative sequence is "ATCTTCT". The net effect of this indel is the insertion of "TCT", although it's hard to say which "TCT" element, the first one or the second one, is inserted.
Another example:
The net effect here is the deletion of several 'cag' repeats. Again, maybe it's impossible to determine which 'cag' elements have been deleted exactly.
It would be great to know the net gain/loss of nucleotides from each indel. The question is, can I always get such net effects (deletion or insertion) of the indels? Is it possible to get an indel composing of both deletion and insertion?
Besides, can a SNP site be treated as a combination of one nt deletion and one nt insertion?
Thanks in advance
Shuli
I'm analyzing SNPs and Indels called from alignments. I always observed indels described as in the following example:
Code:
chr6 111368147 . ATCT ATCTTCT 184 . INDEL;DP=119;AF1=1;CI95=1,1;DP4=0,0,45,58;MQ=20;FQ=-290 GT:PL :GQ 1/1:225,255,0:99
Another example:
Code:
chrX 66765190 . cagcagcagcagcagcagcagcagcagcagcagcagca cagcagca 133 . INDEL;DP=31;AF1=1;CI95=1, 1;DP4=0,0,4,17;MQ=20;FQ=-97.5 GT:PL:GQ 1/1:174,63,0:99
It would be great to know the net gain/loss of nucleotides from each indel. The question is, can I always get such net effects (deletion or insertion) of the indels? Is it possible to get an indel composing of both deletion and insertion?
Besides, can a SNP site be treated as a combination of one nt deletion and one nt insertion?
Thanks in advance
Shuli
Comment