Hi
I am having difficulty understanding how my merged reads are producing a certain amplicon size.
Basically, I have 2 x 251bp reads. This 251bp includes primer sequence, of as far as I understand, 20bp.
When these 251bp reads are merged, they produce an amplicon size of 291bp.
Here is an example of a merged read with amplicon length of 291bp (there are two N's in the sequence as haven't run screen.seqs yet)
>M01822_319_000000000-AG4CF_1_1101_16954_1171
GTGCCAGCCGCCGCGGTAATACATAGGATGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGAGCGCAGGCGGATTTACAAGTCTGATGTTAAAGACAACTGCTTAACGGTTGTTTGCATTGGAAACTGTAAGTCTAGAGTATAGTAGAGAGTTTTGGAACTCCATGTGGAGCGGTGGAATGCGTAGATATATGGAAGAACACCAGAGGCGAAGGCGAAAACTTAGGCTATAACTGACGCTTAGGCTCGAAAGTGTGGGNAGCAAATAGGATTAGATACCCCGGTAGTCN
I have looked at the make.contigs report file and it seems to report that the following (if I am understanding correctly);
Length = 291bp
Overlap length = 211 bp
Total primers = 40bp
Therefore, is the read length 251bp, but merged read length 291bp (as forward and reverse primers included)?
What I don't understand is that each primer length is 20bp, so should the amplicon not be 271bp?
I know I have to remove the primers, but just trying to understand this.
Any help would be greatly appreciated.
Thank you
I am having difficulty understanding how my merged reads are producing a certain amplicon size.
Basically, I have 2 x 251bp reads. This 251bp includes primer sequence, of as far as I understand, 20bp.
When these 251bp reads are merged, they produce an amplicon size of 291bp.
Here is an example of a merged read with amplicon length of 291bp (there are two N's in the sequence as haven't run screen.seqs yet)
>M01822_319_000000000-AG4CF_1_1101_16954_1171
GTGCCAGCCGCCGCGGTAATACATAGGATGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGAGCGCAGGCGGATTTACAAGTCTGATGTTAAAGACAACTGCTTAACGGTTGTTTGCATTGGAAACTGTAAGTCTAGAGTATAGTAGAGAGTTTTGGAACTCCATGTGGAGCGGTGGAATGCGTAGATATATGGAAGAACACCAGAGGCGAAGGCGAAAACTTAGGCTATAACTGACGCTTAGGCTCGAAAGTGTGGGNAGCAAATAGGATTAGATACCCCGGTAGTCN
I have looked at the make.contigs report file and it seems to report that the following (if I am understanding correctly);
Length = 291bp
Overlap length = 211 bp
Total primers = 40bp
Therefore, is the read length 251bp, but merged read length 291bp (as forward and reverse primers included)?
What I don't understand is that each primer length is 20bp, so should the amplicon not be 271bp?
I know I have to remove the primers, but just trying to understand this.
Any help would be greatly appreciated.
Thank you
Comment