Tweet
yeah, that's what the line with grep is supposed to check-whether that string abyss complains about is in there.
-
-
how long should that take..hours or just minutes...mine is already bussy for an hour...Comment
-
Well, for a 1.2 gig file (compressed), my machine needed about 3 minutes (transfering it on a gigabit network) for doing the 'gzip -cd | grep' stanca.Comment
-
I don't get any output at all, if I use the line:
gzip -cd s_7_sequence.fastq.gz | grep "Ms_7_sequence.txt"
But I also already thought that there wouldn't be a line with "Ms_7_sequence.txt"....Comment
-
Yes, no output is what you would get if there was no 'Ms_7_sequence.txt' in there.
Curiouser and curiouser - have you tried passing the un-gziped file (gzip -d name.fastq.gz) to AbySS?Comment
-
That is weird!!! the last time I tried it din't work and now it is reading the file! I'll cross my fingers and hope for the best. Do you have any idea how long it could take? I read somewhere that it can take between 3 and 10 hours...Comment
-
that depends.
What exactly are you trying to assemble, how many reads do you have, etc?.
Generally, assembly can take a long (long) time.Comment
-
Hi all, I'm new here and have a problem.
Maybe its not right place to write but I can not write new post.
I'm using the ABySS for 36bp sequences and now will use the trans-ABySS.
I used command: for k in {18..35}; do ABYSS <file to analyze> -o <where save the file>-k@$k.fa;
My input was file with contigs (after format: fastanrdb) with FASTA extenstion.
I got from ABYSS analysis files. They looks like (examples):
>0 31 117
AGACTTCCCAACATTTATTGCTCTTTCTCTT
>1 35 79
ATGAATTCTATTGGAGATTGTACATTAGTTATGTA
>2 27 60
ATGAATTCTATTGGAGAATGTACATTA
>3 44 666
TTTTTATTTTTGTTCAGAAGGAGTCGTTGGTTGTTCTTCATTTT
>4 111 1332
GATGGTGTAATGAACTCAACAATATCATCTCTTATTACTATATCTGACCGTGCTTATGTAACATTAACTAATTACCAAGGATTGTATAGATTAAATTGTGACCAGAAAACT
>5 18 31
GGAGTGTCGATGCTTGAA
>6 38 213
GCAAATTCTGTTACAATTGATATTTCTCCTTCTGTATA
I have problem with next step of analysis-the trans-Abyss
In manual guide I read that the trans abyss needs specific folder structure.
I dont know what does it means, because I put my results from abyss (in fasta) in folders: LIB0001/kn(15-35)/...fasta (from abyss)
I dont know what is next?
sorry for so complicates question but I am so sad sitting, reading and nothing.....Comment
-
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...04-04-2024, 04:25 PM -
Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...03-22-2024, 06:39 AM
Comment