SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
CNV-seq output (how to know insertion or deletion) younko Bioinformatics 6 08-06-2014 12:51 AM
Velvet assembler ambiguous calls gmarco Bioinformatics 1 06-23-2014 03:02 AM
SOAPdenovo2 Ambiguous output redirect. thh32 Bioinformatics 1 02-19-2014 08:29 AM
Reference Assembly with Ambiguous Chromosomes doc2r Bioinformatics 3 01-20-2011 10:14 AM
samtools rm ambiguous alignment EHC Bioinformatics 0 06-11-2010 09:50 AM

Reply
 
Thread Tools
Old 11-06-2017, 01:16 AM   #1
Medhat
Member
 
Location: Poland

Join Date: Jun 2013
Posts: 36
Default PBSuite spots ambiguous insertion output value

Hi,

Originally I post this question in another place but I could not find an answer.

I am using PBSuite version 15.8.24

`Honey.py spots` was used to identify structure variations.

here is one line of the output showing insertion, my question is: the insertion should be in one point in the genome, so how the output contains start and end ? (does the software add the size to satrt point to find the end point? is there a shift in all genome based on that)


Quote:
1 1211650 1211854 INS 353 zscore=-11.943;szMean=353.000;sz3rdQ=550.000;szCount=5.000;strandCnt=2,3;szMedian=547.000;groupName=1;coverage=14.000;sz1stQ=60.000;mqfilt=0.000
also I visited similar question in https://sourceforge.net/p/pb-jelly/d...read/9b263cf1/

but the output in this post is;

Quote:
lambda_NEB3011 29999 29999 INS 86 zscore=-15.744;GT=1/1;seq=ATTTTCACAAGCGTTATCTTTTACAAAACCGATCTCACTCTCCTTTGATGCGAATGCCAGCGTCAGACATCATATGCAGATACTCA;szMean=89.000;szCount=16.000;sz3rdQ=96.000;consensusCreated=1.000;strandCnt=7,9;szMedian=90.000;groupName=lambda_NEB3011;coverage=16.000;sz1stQ=78.000;mqfilt=0.000;GQ=7.321
were the start and end point is the same `29999`.

is there any explanation?

Thanks
Medhat is offline   Reply With Quote
Old 11-06-2017, 07:33 AM   #2
Markiyan
Member
 
Location: Cambridge

Join Date: Sep 2010
Posts: 97
Lightbulb Some insetrions are flanked with duplication or deletion events...

Quite a few insertional events (esp transposase induced are flanked by the target sequence duplication).
In other cases it can be accompanied by the region deletion/replacement, so it would have both start and stop.

PS: If you have enough reads coverage, assemble the sequences de novo and compare the region of interest in both assemblies using mummer/dotplot/(www)BLAST in master/slave mode.

Also you can use raw read(s) spanning the region of interest and map them using BLAST/BLASR or similar alignment tool which is able to handle the raw pacbio error rate...
Markiyan is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:37 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO