SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
how to know whether a bam file is strand specific? jay2008 Bioinformatics 0 11-28-2012 12:12 AM
how to get specific length sequence from a fasta file entomology Bioinformatics 5 07-12-2012 04:59 PM
Identifying species specific sequence differences gwilymh Bioinformatics 0 05-30-2012 10:50 AM
what specific sequence is used for annealing to flow cell? ein_io Illumina/Solexa 3 12-13-2011 08:56 AM
PubMed: NanoCAGE: a high-resolution technique to discover and interrogate cell transc Newsbot! Literature Watch 0 05-20-2011 12:30 AM

Reply
 
Thread Tools
Old 03-05-2013, 10:55 AM   #1
nasepu
Junior Member
 
Location: Berkeley

Join Date: Sep 2012
Posts: 5
Default Interrogate .fq file for specific sequence?

I found a very suspect major snp when digging through my sequence data, identical to a construct I've previously made in the lab. I'm concerned this is contamination, and it has too significant a phenotype to be ignored. The best way I could think to check if the plasmid somehow made its way in is to check for other stuff that would be on a plasmid, like ampicillin or kanamycin resistance.

I'm unsure what the best way to go about this is. I briefly tried aligning the entire .fq file against the amp gene sequence, which threw an error that can probably be fixed, but the whole idea of trying to align billions of reads against one tiny gene rubbed me the wrong way. Is there a better way to go about this/any tools that would be more useful?
nasepu is offline   Reply With Quote
Old 03-05-2013, 11:48 AM   #2
Bukowski
Senior Member
 
Location: Aberdeen, Scotland

Join Date: Jan 2010
Posts: 373
Default

On the grounds of 'right tool for the right job' using an aligner specifically designed to align ngs reads to a sequence seems like the right way to go to me, as it's likely to be faster than (e.g.) BLAT.

With such a small search space it doesn't seem like the job would take that long - why not try aligning to the vector sequence not just the gene?
Bukowski is offline   Reply With Quote
Old 03-05-2013, 01:32 PM   #3
swbarnes2
Senior Member
 
Location: San Diego

Join Date: May 2008
Posts: 912
Default

Try:

Code:
grep AGTTAGCTCTCGATAGGCTAT read1.fq
For whatever sequence you are looking for.
swbarnes2 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:54 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO