454 fasta qual description format NGS QC toolkit Quality Trimming

[pepperoni]

Hello, I am using NGS QC toolkit to do a quality trimming. Specifically I am using the 454QC_PE.pl tool for 454 paired-end reads. It works perfectly with the example input but not with my data. When I compared the formats of the fasta files they look like this:
my data:
>G7I7FDK01EB4WS rank=0000056 x=1661.0 y=1354.0 length=73
TCGTGTACTCGTATATGTATGCTATACGAGTATGCACCTCGTATACTCGTATA

the example input data:
>E6PIHNP01B74B0 length=157 xy=0795_1886 region=1 run=R_2008_03_05_15_54_49_
TCAGAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCT

so I guess these differences in the description format are what is causing the problem. Does anyone know how can I convert my data into the same format style or how can I directly extract them form the sff file into the same format for the description?

[pepperoni]

I just noticed something else. I checked the script and it says
my $linker = "GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC";

that is the linker for FLX but I used titanium. Does anyone know how can I modify the script in order to include the two linkers for titanium

>titlinker1
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
>titlinker2
CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA

I am not a programmer, and I need to have one or the other, something like:

my $linker = "TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG" or "CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA"