SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Trimmomatic error while executing Irina Pulyakhina Bioinformatics 15 07-03-2015 04:44 AM
Trimmomatic error dvanic Bioinformatics 31 04-06-2015 01:24 AM
Install Trimmomatic? Palgrave Bioinformatics 10 11-02-2014 04:47 AM
duplicate reads in Illumina short, single end reads of RNAseq data inbarpl Bioinformatics 4 05-22-2012 08:36 AM
question about Trimmomatic dejavu2010 Bioinformatics 4 02-27-2012 09:27 AM

Reply
 
Thread Tools
Old 10-16-2012, 06:26 AM   #1
Hilary April Smith
Member
 
Location: USA

Join Date: Jul 2011
Posts: 22
Default Trimmomatic Help Single Reads Error

Hi. I just came across/downloaded the trimmomatic program, but in trying to use it to trim my single reads I am obtaining the errors below. I created a fasta file with my adapters (named as >Universal etc., with the full TruSeq adapter sequences). It seems the program is reading the adapter sequences and starts, but then I receive the errors about the fastq header. I can change the fastq line if I know what it should look like, but I can't discern the format required. (As it is I've had to do some manual adjustments; the sequencing facility gave me separate fastq files for the barcode/index and seq. read files ... without modification my fastq name actually ends in 2:N:0. Note also the last sequence is just my addition of a partial adapter read to make sure Trimmomatic kills it). My short test input file, and the error message, are below. Any help is greatly appreciated!!!


@JLK5VL1:2351BE1ACXX:6:1101:1465:2207 1:N:0:CTTGTA
CTTGTAAGCTGGCTTTAATCGCATCGCTTGAACTTTTTCGCCGACCAGACACACAAATGAATACAGCCCCCTCCGTTTTGACTTGCGCCCCCATCAGAGAGACCAACA
+
@@@DD;DBC@FFFFFHFFHHGJJJJJJFHHGCFHJJJJFFIIJJJBH(BCHEGHEHHEEFE;CEF>@A=?B?BD=ACDB?<ACDCC>BBDDDBCDDCDD@<??<CDD@
@JLK5VL1:2351BE1ACXX:6:1101:1518:2135 1:N:0:CTTGTA
CTTGTAATTTTTTGGTGCGTTTGTTTTTCACAACTGTGTTTTCATATTTCCCTATTTCCCTTGTTCTATTTCCGTTCGACTAGCGCACAGGTAGAAAGTGTTATTTTC
+
@BCFFADBCCFFFDFFHHHHGGIGIIIHIIIJIIIICEGEHIGIIGIIJIIJIGIIHDGIGHHFGHHJJIJG@EHHFEFDDCEDDBDD@?A>:ACCA>>AC@CCCD@:
@JLK5VL1:2351BE1ACXX:6:1101:1676:2243 1:N:0:CTTGTA
CTTGTAACTGTAACCAACTACTACCATTCGCAAGCAATTTCGAGCGAGATGGGTGTATACTTAATACAGACAGACCGTGAGTTGGGATCACACGGCGATGAGCATTCA
+
??1=?4:?@@AAB>B<FDFBFGFG?<FHIIDBGEGC3CFFD?CFIAE<DADFB8;5=F>;C)=4=@CFEEF@3?BDC>??@A@BB@@BBBB>><<9>>5-::>@AABA
@JLK5VL1:2351BE1ACXX:6:1101:1767:2179 1:N:0:CTTGTA
CTTGTAACAACGATCGTATCCTTCGACCGAAACGGTTTAAGCTTTGCTGAAGTAGGTTTTACCCACAGGTTACAGCTGCACTACGCCAACGAACGAAACACTCGACTA
+
@B<DBDD@@@FDDFFFHHGHIIIII<FIGGGEIIIEHHCHBBFGGIIDGFEG@@E@CDHEAAEEEFFFD>CEEEDDDDDDCCCC?:@DDDB<BB<BDB>C@(>?2529
@JLK5VL1:2351BE1ACXX:6:1101:2314:2166 1:N:0:CTTGTA
CTTGTAAGATAAGTGCACGGCAATTGCTAGTTTACCGCTGAATATCGCCGCCCGGATCATTGAGTTCAACGGGTTTGTACCCCTAGGCAGTTTCACGTACTATTTGAC
+
@B@DDDDBCCFFFDFHHHHHJJJJJJJJIJIJJJJJJJJJJIIGIIJJJFIJJJHEFFFEECCCEDDDEDDDDDDDDDEEDDDDDDDDDDDCEDEDBBDDD<CDECD@
@JLK5VL1:2351BE1ACXX:6:1101:2345:2192 1:N:0:CTTGTA
CTTGTAACTGGCACAGATCTTGGTGGTAGTAGCAAATATTCGAACGAGCTCTTGGATGACTGAAGTGGAGAAGGGTTTCGTGTCAACAGCAGTTGAACACGAGTTAGC
+
BC@FFFFCCCFFFFFHHHHHJJJEGIHIJHJJIJJJJIIIIIIJJJGIJJJJJJJFEGGIJDCGIFFIBHGHJHH=ABDDECDEEEDDDDCBDDCDDCDDBBDB(:@C
@JLK5VL1:2351BE1ACXX:6:1101:2311:1710 1:N:0:CTTGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG
+
BC@FFFCCCFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

$ java -classpath trimmomatic-0.22.jar org.usadellab.trimmomatic.TrimmomaticSE -phred33 -trimlog trimlogfile.txt head_rnaseq3_BC11.fastq test1.fastq ILLUMINACLIP:Adapters.fasta:2:40:15 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
TrimmomaticSE: Started with arguments: -phred33 -trimlog trimlogfile.txt head_rnaseq3_BC11.fastq test1.fastq ILLUMINACLIP:Adapters.fasta:2:40:15 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using Clipping Sequence: 'CTAGCCTT ##... (it goes on for all 36 adapter lines, where I gave it sequences for each adapter in the forward, reverse, complement, and rev complement direction. This part looks fine, but then):

ILLUMINACLIP: Using 0 prefix pairs, 36 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Exception in thread "main" java.lang.RuntimeException: Invalid FASTQ name line:
at org.usadellab.trimmomatic.fastq.FastqParser.parseOne(FastqParser.java:51)
at org.usadellab.trimmomatic.fastq.FastqParser.next(FastqParser.java:105)
at org.usadellab.trimmomatic.TrimmomaticSE.processSingleThreaded(TrimmomaticSE.java:55)
at org.usadellab.trimmomatic.TrimmomaticSE.process(TrimmomaticSE.java:197)
at org.usadellab.trimmomatic.TrimmomaticSE.main(TrimmomaticSE.java:262)
Hilary April Smith is offline   Reply With Quote
Old 10-16-2012, 09:22 AM   #2
Hilary April Smith
Member
 
Location: USA

Join Date: Jul 2011
Posts: 22
Default

Hi. Nevermind; I think I may have fixed this...
Hilary April Smith is offline   Reply With Quote
Old 10-17-2012, 05:04 AM   #3
tonybolger
Senior Member
 
Location: berlin

Join Date: Feb 2010
Posts: 156
Default

At a guess, i'd say you have a blank line somewhere in your file, quite likely an extra black line at the end.

If you do a line count using wc -l, you should see a count which is evenly divisible by 4.
tonybolger is offline   Reply With Quote
Old 10-17-2012, 06:05 AM   #4
Hilary April Smith
Member
 
Location: USA

Join Date: Jul 2011
Posts: 22
Default

Yes. I am running it now on my full fastq files and from what I've seen so far, it seems to be working great! It's fantastic to have such an efficient tool for trimming adapters and quality filtering. Thank you.
Hilary April Smith is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:59 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO