
Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation

Similar Threads
Thread Thread Starter Forum Replies Last Post
Dual Indexing for NimbleGen SeqCap geertvandeweyer Sample Prep / Library Generation 1 05-22-2017 01:54 PM
Only one barcode present after dual indexing k_a_r_o_l Bioinformatics 3 03-11-2015 09:19 AM
demultiplexing with dual indexing JBKri Illumina/Solexa 1 10-18-2014 11:47 AM
Dual indexing on NextSeq bryanbriney Illumina/Solexa 1 06-19-2014 06:59 AM
96 or 384 Nextera-style dual indexing pmiguel Illumina/Solexa 3 06-27-2012 09:49 AM

Thread Tools
Old 08-24-2020, 04:57 AM   #1
Junior Member
Location: UK

Join Date: Sep 2018
Posts: 4
Default i5 / i7 dual indexing + ATAC


I am constructing an ATAC-seq library using the standard Illumina kit (Nextera DNA Flex Library Prep, FC-121-1030). A previous user suggested dual indexing to minimise index hopping which I am grateful for. We have access to a Hiseq X-Ten (paired-end 100bp) and illumina suggests to use the reverse complement of the Index (i5) adapter sequence:


What should I order to amplify my transposed libraries? For example with the H502 i5 index: unique bases in adapter = CTCTCTAT, does that mean I would order a primer with the reverse complement (ATAGAGAG) for the unique portion of an i5 standard index? = AATGATACGGCGACCACCGAGATCTACAC [ATAGAGAG] TCGTCGGCAGCGTC instead of AATGATACGGCGACCACCGAGATCTACAC [CTCTCTAT] TCGTCGGCAGCGTC as was used in this protocol presumably becuase they used a different sequencer:

From the original ATAC-seq protocol, they add the following bases to the 3' end of a standard i5 adapter that doesn't contain a unique index sequence. I'd imagine this is to mitigate loss of the 8 base unique index, but they've also added a few bases to the 3' end of the i7 adapters (AGATGT) that do contain a unique index sequence. Should I include this (AGATGTG) to my i5 primer order and can I use these with the i7 adapters as given in the in the Buenrostro 2013 protocol which include the extra 3' bases (AGATGT)?

ETBA is offline   Reply With Quote
Old 08-24-2020, 09:51 AM   #2
Senior Member
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,077

GenoMax is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 02:36 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO