NEBNext 454 rapid library

[TonyBrooks]

Hi all
We're looking to make some standard genomic rapid libraries for 454 sequencing.
We've sucessfully used the NEBNext rapid library kit with the Roche RL-MID set, but we need to make non-MID adapters for some standard gDNA libraries. I wondered if anyone has tried making home-made adapters.
I'm assuming they'll be the same sequences as the extended MID set but without the 10 base index. Going by the sequences on the IDT site, that would be;

With MID (index in square brackets)

5FAMC*C*A*T*CTCATCCCTGCGTGTCTCCGACGACT[AGACTC-G*A*C*G]*T3
..............................|||||||| ||||||.|.|.|.|
3G*G*A*T*AGGGGACACACGGAACTCTCTGCIGCTGI[TCTGIG*C*T*G*C](phos)5


Without MID

5FAMC*C*A*T*CTCATCCCTGCGTGTCTCCGACGACT*T3
..............................||||||||
3G*G*A*T*AGGGGACACACGGAACTCTCTGCIGCTGI(phos)5


I'm not worried about including the FAM as we don't quantify by flourescence
So my questions are;
Are the inosines, really necessary?
Are the phosphorothioates necessary on the adapter tails? We don't have them on our Illumina homebrew adapters, just the one preceeding the T overhang.
Are 8 complementary bases enough to anneal into a Y-adapter?

I would appreciate it if anyone could share the adapter sequences they use.

Tony

[zhengz]

Just my personal views.

Are the inosines, really necessary?
-- Not necessary with the short stem.

Are the phosphorothioates necessary on the adapter tails? We don't have them on our Illumina homebrew adapters, just the one preceeding the T overhang.
-- It is known that phosphorothioates bonds help to prevent the ends (priming sites) from degradation. At high lib concentration, the difference between libs with and without such bonds might be too little to appreciate. At low lib conc., or near the level before feeding emPCR, the bonds might have noticeable effect on the reproducibility of enrichment% using this low conc. lib.

Are 8 complementary bases enough to anneal into a Y-adapter?
-- Yes, I think so. The annealing T might be somewhere around 40-50 C.