SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Indel detection in high coverage amplicons sequenced by MiSeq lpalacios Bioinformatics 2 02-24-2015 06:04 AM
Reproduce genome coverage of ENCODE-CSHL Long RNA-seq data, but failed? josephyan RNA Sequencing 1 10-31-2012 03:51 PM
Sequencing microsatellite enriched DNA amplicons on MiSeq Polar314 Illumina/Solexa 1 03-20-2012 01:12 AM
Kits for sequencing long amplicons on MiSeq odile Illumina/Solexa 0 03-07-2012 12:50 PM
paired-end run failed in pipeline v1.3.2 ttkuaile Bioinformatics 1 04-17-2009 01:30 PM

Reply
 
Thread Tools
Old 11-29-2012, 09:24 AM   #1
JamieHeather
@jamimmunology
 
Location: London

Join Date: Nov 2012
Posts: 96
Default Long amplicons failed to sequence in MiSeq run (where shorter random DNA succeeded)

Hi SEQanswers,

Our third MiSeq running trying our various protocol incarnations has failed, just wondered if anyone might have any ideas as to what's going wrong.

We're trying to sequence one of the human variable antigen receptor repertoires, so our amplicons are variable, containing central regions of random sequence bordered by heterologous but related sequence, that has a one of three fixed constant region on one end (which is where we target one of our primers).

Our first two goes on the MiSeq were unsuccessful; we tried to do quite a specific custom reaction, and perhaps tried too many custom variables (which was discussed briefly on this forum).

Essentially we amplified the P5 element upstream of our 3 constant sequences, and indexing and P7 oligos at the other end, then tried to sequence off 3 custom oligos directed against those constant regions. We got very few clusters, even fewer passed filter, and the sequences that came out was almost entirely low quality junk. Thinking it might be a diversity problem, we spiked in PhiX, after which we got a great run of just PhiX sequence.

After getting advice from Illumina and some contributors on here, it seemed the consensus was that either the low diversity or custom primers were likely to blame. To solve it we thought we'd introduce the Illumina SP1 site upstream of the constant primer sequence, with a random hexamer (NNNNNN) in between to provide the diversity over the first few bases. Our libraries should look like this:

P5 - SP1 - NNNNNN - PCR primer 1 - amplicon - PCR primer 2 - indexing oligo - index - P7

We then ran this on a v2 kit, in a 500bp SE reaction. We included a 5% PhiX spike in, along with two indexes (out of 12) of unrelated, randomly sheared viral genomic DNA, meaning an approximate spike in of ~21% random DNA spike in.

We don't have loads of clusters, but most of them pass filter, which was encouraging relative to our previous runs where very few did. We got about 300 bases of good quality read (with the funny increasing intensity which I'm told is typical of v2 chemistry). However, the vast majority of it is either PhiX or one of the two indexed viral samples.

The major thing that I can think of that differentiates our samples from the viral samples (apart from the diversity) is the length; the peak size of the viral samples (and the PhiX, presumably) is in the 300-400 bp range, while ours are somewhere between 700 and 900 bp. Ours also aren't normally distributed like the sheared libraries are.

I saw that some people are finding lower cluster densities on the v2 chemistry; is it possible that the shorter fragments are just out competing the longer in the bridge amplification? Or is something else going on?

As ever, any help or insight is very much appreciated.
Attached Images
File Type: png Selection_152.png (57.5 KB, 28 views)
File Type: png Selection_154.png (15.2 KB, 20 views)
JamieHeather is offline   Reply With Quote
Old 11-30-2012, 01:41 AM   #2
Vinz
Member
 
Location: Germany

Join Date: Dec 2010
Posts: 80
Default

My best guess would be that something with your construct is wrong. Maybe you should post your sequence setup.
Have you tried to quantify by Q-PCR with the Kappa kit?
I think the length of the inserts should not be a problem.
Vinz is offline   Reply With Quote
Old 11-30-2012, 01:56 AM   #3
JamieHeather
@jamimmunology
 
Location: London

Join Date: Nov 2012
Posts: 96
Default

Is a fair point, but I think they should be OK. The set up is this:

P5 - SP1 - NNNNNN - PCR primer 1 - amplicon - PCR primer 2 - indexing oligo - index - P7

Which translates to:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNN - PCR primer 1 - amplicon - PCR primer 2 - AGATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGCCGTCTTCTGCTTG

I've cloned and sequenced similar libraries (from the previous run, where we were trying our own custom primers), and the sequences check out as a) what we intended to make and b) sequences that should hybridise and amplify on the flow cell (checked with Illumina tech), so I don't tend to think the sequences are likely at fault.

Additionally, I did check that they amplify off both P5 and P7 sequences, as well as with SP1 and P7, and they do for both (which I'm interpreting as meaning they're feasible libraries for bridge amplification and subsequent SP1 sequencing).

However, I've not quantified by qPCR, only ran samples on bioanalyser and qubit.

Last edited by JamieHeather; 11-30-2012 at 02:34 AM. Reason: Corrected typo in index sequencing primer
JamieHeather is offline   Reply With Quote
Old 11-30-2012, 02:31 AM   #4
Vinz
Member
 
Location: Germany

Join Date: Dec 2010
Posts: 80
Default

The only problem I can spot is that you miss one A after PCR primer 2:
It should be AGATCGG... to match the reverse read sequencing primer which ends with ...TCT
However that would not explain why read1 is also bad...
Vinz is offline   Reply With Quote
Old 11-30-2012, 02:35 AM   #5
JamieHeather
@jamimmunology
 
Location: London

Join Date: Nov 2012
Posts: 96
Default

Oops, sorry - I must have accidentally deleted that when I was sorting the italics, corrected.

Read 1 is working to some extent, getting an average few 1000 reads per index, just clearly not as well as it should be.

Edit: incidentally, read 2 appears to be working fine; most clusters get indexed correctly, it looks on cursory examination that the unindexed output is mostly just PhiX.
JamieHeather is offline   Reply With Quote
Old 11-30-2012, 02:40 AM   #6
Benny Chain
Junior Member
 
Location: UCL, London

Join Date: Dec 2011
Posts: 4
Question missmatched lengths

Vinz : do you have any experience of mixing fragments of very different length together on a single flow cell ? I was thinking perhaps there could be competition during the bridge PCR ?
Benny Chain is offline   Reply With Quote
Old 11-30-2012, 03:59 AM   #7
Vinz
Member
 
Location: Germany

Join Date: Dec 2010
Posts: 80
Default

I would recommend you quantify by Q-PCR. Maybe you are overestimating the amount of PCR-ready DNA. Assuming that everything is ok with your construct you could also increase the amount of PCR product that you put in based on the number of reads you got so far.
(We have not done amplicons above 600bp)
Vinz is offline   Reply With Quote
Reply

Tags
amplicon sequencing, clusters, diversity, illumina, miseq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:11 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO