SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie, an ultrafast, memory-efficient, open source short read aligner Ben Langmead Bioinformatics 513 05-14-2015 02:29 PM
Introducing BBMap, a new short-read aligner for DNA and RNA Brian Bushnell Bioinformatics 24 07-07-2014 09:37 AM
Miso's open source joyce kang Bioinformatics 1 01-25-2012 06:25 AM
Targeted resequencing - open source stanford_genome_tech Genomic Resequencing 3 09-27-2011 03:27 PM
EKOPath 4 going open source dnusol Bioinformatics 0 06-15-2011 01:10 AM

Reply
 
Thread Tools
Old 07-25-2018, 04:24 PM   #641
olgabot
Junior Member
 
Location: San Francisco, CA

Join Date: Apr 2014
Posts: 1
Default Add hg19 masked reference to distribution

Hello,
I'm using BBTools via bioconda and the corresponding quay.io docker container. The image has the necessary resources, e.g. the adapters fasta file:

Code:
(base) 
 Wed 25 Jul - 17:10  ~/code/tick-genome/reflow   origin ☊ master 9☀ 1● 
  docker run -it -v $PWD:/data quay.io/biocontainers/bbmap:38.06--2 bash
bash-4.2# find . -name adapters.fa
./usr/local/opt/bbmap-38.06/resources/adapters.fa
bash-4.2# cd ./usr/local/opt/bbmap-38.06/resources
bash-4.2# ll
bash: ll: command not found
bash-4.2# ls 
adapters.fa                          blacklist_silva_species_500.sketch   lambda.fa.gz                         nextera_LMP_linker.fa.gz             primes.txt.gz                        sequencing_artifacts.fa.gz
adapters_no_transposase.fa.gz        contents.txt                         lfpe.linker.fa.gz                    pJET1.2.fa                           remote_files.txt                     short.fa
blacklist_img_species_300.sketch     crelox.fa.gz                         mtst.fa                              phix174_ill.ref.fa.gz                remote_files_old.txt                 truseq.fa.gz
blacklist_nt_species_1000.sketch     favicon.ico                          nextera.fa.gz                        phix_adapters.fa.gz                  sample1.fq.gz                        truseq_rna.fa.gz
blacklist_refseq_species_250.sketch  kapatags.L40.fa                      nextera_LMP_adapter.fa.gz            polyA.fa.gz                          sample2.fq.gz
However, the removehuman.sh script uses a hardcoded path for the masked human genome posted in the RemoveHuman thread.


Code:
	local CMD="java -Djava.library.path=$NATIVELIBDIR $EA $z -cp $CP align2.BBMap minratio=0.9 maxindel=3 bwr=0.16 bw=12 quickmatch fast minhits=2 path=/global/projectb/sandbox/gaag/bbtools/hg19 pigz unpigz zl=6 qtrim=r trimq=10 untrim idtag usemodulo printunmappedcount usejni ztd=2 kfilter=25 maxsites=1 k=14 [email protected]
Can the masked genome be included in the distribution?

Thank you!
Warmest,
Olga
olgabot is offline   Reply With Quote
Old 08-07-2018, 07:45 AM   #642
sunnycqcn
Member
 
Location: Canada

Join Date: Apr 2013
Posts: 17
Default

Hello Brian,
After running mapPacBio.sh, how can I combine the sequence of the same ID?
for example I want to combine the sequences as following:
m151006_234406_42219_c100867912550000001823195203031665_s1_p0/110457/57769_70466 id=3_0_part_2_6
m151006_234406_42219_c100867912550000001823195203031665_s1_p0/110457/57769_70466 id=3_0_part_3

Thanks,
Fuyou
sunnycqcn is offline   Reply With Quote
Old 08-09-2018, 05:56 AM   #643
JenBarb
Member
 
Location: Bethesda, MD

Join Date: Oct 2010
Posts: 47
Default pull out sequences with matching primers

Hi Brian,
I was wondering if bbmap has a tool that will pull out reads matching a particular primer sequences? I have fastq files with amplicons from 12 different primers in the same file so i want to make subsets of the reads having specific primers of interest from this.

i have used your tool for other tasks so i figured I would ask if it also has this capability?

Thank you,
Jen
JenBarb is offline   Reply With Quote
Old 08-09-2018, 06:08 AM   #644
HESmith
Senior Member
 
Location: Bethesda MD

Join Date: Oct 2009
Posts: 498
Default

@JenBarb see this thread in Biostars.
HESmith is offline   Reply With Quote
Old 08-09-2018, 07:09 AM   #645
JenBarb
Member
 
Location: Bethesda, MD

Join Date: Oct 2010
Posts: 47
Default

Thank you! Love the tool!
JenBarb is offline   Reply With Quote
Old Yesterday, 09:05 PM   #646
Meyana
Member
 
Location: Japan

Join Date: Sep 2017
Posts: 21
Default

Hi,
Hoping somebody can help me with this.

I used BBMap and now I would like to extract the reads from by .bam file that are split (/chimeric?) ie. reads that indicate a deletion.

I tried to use samblaster, but it doesn't recognize any reads as split...
(samtools view -h in.bam | samblaster -a -s split.sam -o /dev/null)
Are the split reads marked differently in BBMap compared to other aligners causing samblaster to fail?

IGV shows a good amount of reads with deletions and I can also call deletions using BBTools callvariants.sh - so I know they are in there. I just have a feeling callvariants is calling fewer deletions and with lower coverage than what IGV suggests, so I want to check up on it.
Meyana is offline   Reply With Quote
Old Today, 09:45 AM   #647
JenBarb
Member
 
Location: Bethesda, MD

Join Date: Oct 2010
Posts: 47
Default mkf argument in bbduk.sh (bbmap tool)

Hello,
I am trying to use the flag mkf (minkmerfraction) and I am getting an error that that argument does not exist.
sh /data/barbj/bbmap/bbduk.sh in=./../Stool_001-01.fastq outm=v2fstoolfq.fa literal=CTCAAACTTGGGTAATTAAACC k=17 mkf=0.8
java -Djava.library.path=/data/barbj/bbmap/jni/ -ea -Xmx39767m -Xms39767m -cp /data/barbj/bbmap/current/ jgi.BBDukF in=./../Stool_001-01.fastq outm=v2fstoolfq.fa literal=CTCAAACTTGGGTAATTAAACC k=17 mkf=0.8
Executing jgi.BBDukF [in=./../Stool_001-01.fastq, outm=v2fstoolfq.fa, literal=CTCAAACTTGGGTAATTAAACC, k=17, mkf=0.8]

Exception in thread "main" java.lang.RuntimeException: Unknown parameter mkf=0.8
at jgi.BBDukF.<init>(BBDukF.java:402)
any ideas why this is not working?

Jen
JenBarb is offline   Reply With Quote
Reply

Tags
bbmap, metagenomics, rna-seq aligners, short read alignment

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:01 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO