SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Too many forward only surviving unpaired reads after trimmomatic (RNA-Seq data) BrianU Bioinformatics 21 05-14-2015 07:21 AM
Trimmomatic Paired End - Low number of surviving reads BADE Bioinformatics 17 10-29-2014 10:37 AM
Do we need two DIFFERENT adapters to generate Pair-end Reads ? byou678 Illumina/Solexa 1 02-08-2013 03:23 PM
Do we need two adapters to generate Pair-end Reads ? byou678 Bioinformatics 4 02-07-2013 09:05 AM

Reply
 
Thread Tools
Old 08-05-2018, 10:00 PM   #1
criscruz
Junior Member
 
Location: Peru

Join Date: Aug 2015
Posts: 7
Default why i have less than 50% reads surviving in pair after trimming adapters?

Hi All.

I'm using a ramdom amplification protocol and for library preparation I'm using Nextera XT. I'm performing seq step with Miseq reagent kit v3 600 cycles but i only use 200 cycles instead of 300 in order to get better quality score.

After adapters trimmed with Trimmomatic I've got this result:

TrimmomaticPE: Started with arguments:
-phred33 -trimlog 12143_trimlog.txt 12143_R1.fastq.gz 12143_R2.fastq.gz 12143_FWP.fq.gz 12143_FWUP.fq.gz 12143_REVP.fq.gz 12143_REVUP.fq.gz ILLUMINACLIP:/home/dell/miniconda3/share/trimmomatic/adapters/NexteraPE-PE.fa:2:30:10
Multiple cores found: Using 4 threads
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 2764988 Both Surviving: 658763 (23.83%) Forward Only Surviving: 2105922 (76.16%) Reverse Only Surviving: 288 (0.01%) Dropped: 15 (0.00%)
TrimmomaticPE: Completed successfully

FastQC basic statistics for forward before triimmig
Encoding Sanger / Illumina 1.9
Total Sequences 2764988
Sequences flagged as poor quality 0
Sequence length 201
%GC 42

FastQC basic statistics for forward paired after triimmig
Encoding Sanger / Illumina 1.9
Total Sequences 658763
Sequences flagged as poor quality 0
Sequence length 1-201
%GC 41
Why I have a very low % of both surviving and why a high value for forward only?

I really appreciate your feedbacks.


thanks

Chris

Last edited by criscruz; 08-05-2018 at 10:31 PM.
criscruz is offline   Reply With Quote
Old 08-06-2018, 06:51 AM   #2
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,155
Default

Quote:
Originally Posted by criscruz View Post
<CLIP>
Why I have a very low % of both surviving and why a high value for forward only?

I really appreciate your feedbacks.


thanks

Chris
This result indicates that your library included a large percentage of fragments with insert size less than or equal to 200bp in length. The way Trimmomatic paired end trimming operates (by default) when it finds the forward and reverse read overlap 100% (i.e. the insert is shorter than the read length) it keeps read 1 and discards read 2. The result is read 1 (forward) surviving but read 2 (reverse) not. When the overlap is only partial or not at all (i.e. insert is > 200bp) both read 1 and read 2 survive.
kmcarr is offline   Reply With Quote
Old 08-08-2018, 08:27 PM   #3
criscruz
Junior Member
 
Location: Peru

Join Date: Aug 2015
Posts: 7
Default

thanks so much kmcarr
criscruz is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:19 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO