SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
RNA-Seq: Single Read and Paired End mRNA-Seq Illumina Libraries from 10 Nanograms Tot Newsbot! Literature Watch 0 11-09-2011 02:10 AM
How to multiplex Illumina matepair libraries? versa Sample Prep / Library Generation 3 10-24-2011 05:01 AM
Dynabeads mRNA isolation problem bunnymac Sample Prep / Library Generation 5 05-09-2011 01:09 PM
A possible problem with multiplex tags just occurred to me kmcarr Illumina/Solexa 2 06-29-2009 11:25 AM
qPCR quantification of mRNA seq libraries: strange amplicon sizes Martin_Ranik Illumina/Solexa 2 06-23-2009 04:31 AM

Reply
 
Thread Tools
Old 09-14-2010, 11:45 PM   #1
sc10021
Junior Member
 
Location: cambridge

Join Date: Aug 2010
Posts: 6
Default problem with mRNA multiplex libraries

I have been trying to generate mRNA-SEQ multiplex libraries using the multiplex kit from Illumina but my end repair, dA-tailing and ligation reagents are from NEB labs. I have no problem generating a smear post PCR if I use the standard Illumina PE reagents but do not see any PCR smears using the multiplex kit. I cannot see what is the difference in the protocol except using different adapters and primers. Can anyone help please? Thanks
sc10021 is offline   Reply With Quote
Old 10-14-2010, 09:21 AM   #2
gford
Junior Member
 
Location: Alberta

Join Date: Sep 2009
Posts: 3
Default re: problem with mRNA multiplex libraries

I've just finished making 300 bp indexed paired end mRNA-seq libraries using these reagents and saw the expected smears on a Bioanalyzer, though they haven't been sequenced yet.
gford is offline   Reply With Quote
Old 10-25-2010, 02:49 AM   #3
josdegraaf
Member
 
Location: Germany

Join Date: Mar 2010
Posts: 33
Default

How many pcr rounds did you both use?
josdegraaf is offline   Reply With Quote
Old 10-25-2010, 08:34 AM   #4
gford
Junior Member
 
Location: Alberta

Join Date: Sep 2009
Posts: 3
Default

I titrated the number of Phusion PCR cycles to 17 for one sample, and 19 on the remaining 4.
gford is offline   Reply With Quote
Old 11-05-2010, 03:01 PM   #5
JMorlan
Junior Member
 
Location: Redwood City, CA

Join Date: Oct 2010
Posts: 4
Default

We recently completed an RNA-seq study combining Illumina's RNA-Seq protocol and multiplex kit and running on the GAIIx. Our data quality was excellent in terms of total read yield, %Q30, % unique mapping, etc. The only caveat is that library yields are rather dramatically reduced (a few were right at 10 nM post-PCR) compared to the standard protocol but we always had more than enough to cluster.

Illumina has confirmed with us that the multiplex kit reduces library yields (hence the increase to 18 cycles in the protocol).

I would recommend that you quantitate rather precisely (qPCR or PicoGreen) as you may just have low-yield libraries.

Incidentally, we also use a "Home-Brew" version of Illumina's RNA-Seq kit, with reagents/oligos purchased from 3rd-party suppliers (the Illumina kits are a bit expensive) so I don't think it's a problem that you are using NEB kits.

-John
JMorlan is offline   Reply With Quote
Old 11-06-2010, 12:23 AM   #6
josdegraaf
Member
 
Location: Germany

Join Date: Mar 2010
Posts: 33
Default

We also did this several times now, using NEB as well as Illumina reagents and it works fine, we also had low yields but more then enough.
josdegraaf is offline   Reply With Quote
Old 01-11-2011, 12:28 PM   #7
amango
Member
 
Location: New York

Join Date: Dec 2009
Posts: 17
Default problems with indexed paired-end mRNA-seq

JMorlan, gford, josdegraaf and anyone else,
I am working on a 'homemade' paired-end indexed mRNA-seq protocol. I am having trouble amplifying my adapter-ligated library (or maybe I'm having trouble with ligation). Would you be willing to send me your protocol and adapter & PCR sequences?

I am using the following adapter sequences, derived from another SEQanswers post (http://seqanswers.com/forums/showpos...5&postcount=13). 6-bp index tags are denoted by NNNNNN.

PEMx1 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNN*T
PEMx2 5’-pnnnnnnAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

I plan to ligate different unique-index adapter set to my different libraries. And then enrich all libraries with these universal primers:

PCR PE1 5’-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAAC CGCTCTTCCGATCT
PCR PE2 5' - AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA CGCTCTTCCGATCT

Am I correct that I do not need any PCR primers specific to my indexed adapters?

Any help would be appreciated!

Last edited by amango; 01-11-2011 at 02:29 PM. Reason: addressed too narrowly
amango is offline   Reply With Quote
Old 01-12-2011, 09:23 AM   #8
JMorlan
Junior Member
 
Location: Redwood City, CA

Join Date: Oct 2010
Posts: 4
Default

Hi amango,

I should clarify that we did not use our 'Homebrew' RNA-Seq protocol on the multiplexing study I mentioned in my earlier post. For multiplexing we used Illumina's now obsolete Multiplexing Sample Preparation Oligonucleotide Kit. The protocol can be found on Illumina's website.

From your sequences it looks as if you are trying to have the barcode incorporated into the read itself. Just be aware that Illumina does not recommend this strategy (although that does not mean it can't be done).

To answer your question, since you are just adding a barcode to the end of your adapters, I would imagine you should be able to use the standard Illumina primers.

As for the problems you are having, some questions for you:

-Are you annealing your adapter oligos together (for example, with heating, slow-cooling) before you use them in ligation?
-Have you estimated the concentration of annealed adapter to use in ligation relative to your input template?

FYI, Illumina's new TruSeq RNA-Seq kits have multiplexing capability built in and are much less expensive than their earlier RNA-Seq Kits on a per sample basis (about $66/sample by my figuring). You might want to give that a try if you are still hitting a wall with your homebrew.

Good Luck,

JMorlan
JMorlan is offline   Reply With Quote
Old 01-27-2011, 01:30 PM   #9
jowenMIT
Junior Member
 
Location: Cambridge

Join Date: Oct 2009
Posts: 2
Default

I agree with Jmorlan about properly annealing the adapters. I forgot to do this with some homemade adapters, and it resulted in an almost complete lack of proper ligation.
jowenMIT is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:08 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO