I found an error about annotation gene.
In my result, one candidates report by tophat-fusion as follwing:
T2852 chr15-chr12 62173825 6979426 ff
6 1 6 2 35 41
TTACTGTACTCATTAAATCTTGTGATGACACTCACATCAATGAAAGGCTT AGGCTCTGTGACTGGGGCAACCTGCAAGGAGCTGGCCAGCCAGCCTGATG
00000000000000066666666666666666666666666666666666 66666666666666666666666666666666666666666000000000
VPS13C exon15(62173760-62173830) TPI1 exon7(6979427-6980109)
The error is that VPS13C express from genome revere site, the exon number is 71 instead of 15 (total exon number is 86).
exon number in genome:86<-85<-84.....71<--- (true)
exon number in genome:1->2->3->.....->15-> (error)
In my result, one candidates report by tophat-fusion as follwing:
T2852 chr15-chr12 62173825 6979426 ff
6 1 6 2 35 41
TTACTGTACTCATTAAATCTTGTGATGACACTCACATCAATGAAAGGCTT AGGCTCTGTGACTGGGGCAACCTGCAAGGAGCTGGCCAGCCAGCCTGATG
00000000000000066666666666666666666666666666666666 66666666666666666666666666666666666666666000000000
VPS13C exon15(62173760-62173830) TPI1 exon7(6979427-6980109)
The error is that VPS13C express from genome revere site, the exon number is 71 instead of 15 (total exon number is 86).
exon number in genome:86<-85<-84.....71<--- (true)
exon number in genome:1->2->3->.....->15-> (error)
Comment